Hymenopyramis brachiatandhF · NADH dehydrogenase subunit F1067 bp
AAGTGCTTTATTTCATTTGATTACTCATGCTTATTCCAAAGCATTATTATTTTTAGGGTCCGGGTCCGTTATTCATTCAATGGAAACTGTTGTTGGTTAT…Open sequence
Accession evidence record
FM200139.1
Records attached to this accession in the current public release.
Linked records
An accession can support an omics layer, a DNA record or both.
| Record type | Species | Gene | Length | |
|---|---|---|---|---|
| Chloroplast genome | Hymenopyramis brachiata | — | — | Open record |
| DNA sequence | Hymenopyramis brachiata | ndhF | 1067 bp | Open record |
DNA sequence records
Nucleotide sequence content linked to this accession.
Record boundary
This page reports only relationships present in the LamiOmicsDB release; it does not reproduce an external database record in full.