Peronema canescensrps15 · ribosomal protein S1572 bp
ATGGTAAAAAATTCATTCATTTCGGTTATTTCTCAAAAAGAAAACGAAGAAAACAGAGGGTCTGTTGAATTCOpen sequence
Accession evidence record
OK064490.1
Records attached to this accession in the current public release.
Linked records
An accession can support an omics layer, a DNA record or both.
| Record type | Species | Gene | Length | |
|---|---|---|---|---|
| Chloroplast genome | Peronema canescens | — | — | Open record |
| DNA sequence | Peronema canescens | rps15 | 72 bp | Open record |
| DNA sequence | Peronema canescens | ycf1 | 5565 bp | Open record |
DNA sequence records
Nucleotide sequence content linked to this accession.
Peronema canescensycf1 · Ycf15565 bp
ATGATTTTTCAATCTTTTCTACTAGGTAATCTAGTATCCTTATGCATGAAGATAATCAATTCGGTCGTTGTGGTCGGACTCTATTATGGATTTCTGACCA…Open sequence
Record boundary
This page reports only relationships present in the LamiOmicsDB release; it does not reproduce an external database record in full.