MN814854ATGATTTTTCAATCTTTTCTACTAGGTAATCTAGTATCCTTATGCATGAAGATAATCAATTCGGTCGTTGTGGTCGGACTCTATTATGGA…
Gene evidence record
Hypothetical chloroplast reading frame 1
Curated function is shown separately from locus and sequence evidence.
A variable plastome locus useful in comparative analyses.
Species-level DNA, coordinate and organelle coverage for this symbol.
| Species | Taxonomy | Organelle | DNA records | Coordinate loci | Accessions | |
|---|---|---|---|---|---|---|
| Agastache rugosa | NepetoideaeAgastache | chloroplast | 1 | 2 | NC_053706NC_053706.1 | Species evidence |
| Ajuga bracteosa | AjugoideaeAjuga | chloroplast | 1 | 2 | NC_068635NC_068635.1 | Species evidence |
| Ajuga campylantha | AjugoideaeAjuga | chloroplast | 1 | 2 | NC_084165NC_084165.1 | Species evidence |
| Ajuga campylanthoides | AjugoideaeAjuga | chloroplast | 1 | 2 | MN814852MN814852.1 | Species evidence |
| Ajuga ciliata | AjugoideaeAjuga | chloroplast | 1 | 2 | MN814853MN814853.1 | Species evidence |
| Ajuga decumbens | AjugoideaeAjuga | chloroplast | 1 | 2 | MN814854MN814854.1 | Species evidence |
| Ajuga forrestii | AjugoideaeAjuga | chloroplast | 1 | 1 | NC_048512NC_048512.1 | Species evidence |
| Ajuga genevensis | AjugoideaeAjuga | chloroplast | 1 | 2 | PP024532PP024532.1 | Species evidence |
| Ajuga lupulina | AjugoideaeAjuga | chloroplast | 1 | 2 | PV243805PV243805.1 | Species evidence |
| Ajuga macrosperma | AjugoideaeAjuga | chloroplast | 1 | 2 | NC_084166NC_084166.1 | Species evidence |
| Ajuga multiflora | AjugoideaeAjuga | chloroplast | 1 | 2 | PQ178989PQ178989.1 | Species evidence |
| Ajuga nipponensis | AjugoideaeAjuga | chloroplast | 1 | 2 | NC_084167NC_084167.1 | Species evidence |
| Ajuga nubigena | AjugoideaeAjuga | chloroplast | 1 | 2 | NC_071844NC_071844.1 | Species evidence |
| Ajuga ovalifolia | AjugoideaeAjuga | chloroplast | 1 | 2 | NC_084168NC_084168.1 | Species evidence |
| Ajuga pyramidalis subsp. pyramidalis | AjugoideaeAjuga | chloroplast | 1 | 2 | PP024533PP024533.1 | Species evidence |
| Ajuga reptans | AjugoideaeAjuga | chloroplast | 1 | 2 | PP024534PP024534.1 | Species evidence |
| Ajuga turkestanica | AjugoideaeAjuga | chloroplast | 1 | 2 | PV192927PV192927.1 | Species evidence |
| Ajugoides humilis | LamioideaeAjugoides | chloroplast | 1 | 1 | OR565921OR565921.1 | Species evidence |
| Amethystea caerulea | AjugoideaeAmethystea | chloroplast | 1 | 1 | NC_068628NC_068628.1 | Species evidence |
| Ballota nigra | LamioideaeBallota | chloroplast | 1 | 2 | NC_066022NC_066022.1 | Species evidence |
| Ballota nigra subsp. meridionalis | LamioideaeBallota | chloroplast | 1 | 2 | PP840338PP840338.1 | Species evidence |
| Betonica alopecuros | LamioideaeBetonica | chloroplast | 1 | 2 | PP103299PP103299.1 | Species evidence |
| Callicarpa americana | CallicarpoideaeCallicarpa | chloroplast | 1 | 1 | NC_052696NC_052696.1 | Species evidence |
| Callicarpa bodinieri | CallicarpoideaeCallicarpa | chloroplast | 1 | 1 | NC_054294NC_054294.1 | Species evidence |
| Callicarpa brevipes | CallicarpoideaeCallicarpa | chloroplast | 1 | 2 | NC_058322NC_058322.1 | Species evidence |
| Callicarpa cathayana | CallicarpoideaeCallicarpa | chloroplast | 1 | 1 | NC_063508NC_063508.1 | Species evidence |
| Callicarpa dichotoma | CallicarpoideaeCallicarpa | chloroplast | 1 | 2 | LC775283LC775283.1 | Species evidence |
| Callicarpa formosana | CallicarpoideaeCallicarpa | chloroplast | 1 | 2 | NC_052748NC_052748.1 | Species evidence |
| Callicarpa kochiana | CallicarpoideaeCallicarpa | chloroplast | 1 | 1 | NC_063509NC_063509.1 | Species evidence |
| Callicarpa kwangtungensis | CallicarpoideaeCallicarpa | chloroplast | 1 | 1 | NC_084107NC_084107.1 | Species evidence |
| Callicarpa longifolia | CallicarpoideaeCallicarpa | chloroplast | 1 | 2 | NC_084175NC_084175.1 | Species evidence |
| Callicarpa longifolia var. floccosa | CallicarpoideaeCallicarpa | chloroplast | 1 | 1 | MW149076MW149076.1 | Species evidence |
| Callicarpa longipes | CallicarpoideaeCallicarpa | chloroplast | 1 | 1 | OR548044OR548044.1 | Species evidence |
| Callicarpa longipes var. mixiensis | CallicarpoideaeCallicarpa | chloroplast | 1 | 1 | OR537888OR537888.1 | Species evidence |
| Callicarpa longissima | CallicarpoideaeCallicarpa | chloroplast | 1 | 1 | NC_088747NC_088747.1 | Species evidence |
| Callicarpa macrophylla | CallicarpoideaeCallicarpa | chloroplast | 1 | 2 | NC_058323NC_058323.1 | Species evidence |
| Callicarpa nudiflora | CallicarpoideaeCallicarpa | chloroplast | 1 | 1 | PV929844PV929844.1 | Species evidence |
| Callicarpa peichieniana | CallicarpoideaeCallicarpa | chloroplast | 1 | 2 | NC_058324NC_058324.1 | Species evidence |
| Callicarpa rubella | CallicarpoideaeCallicarpa | chloroplast | 1 | 1 | NC_058533NC_058533.1 | Species evidence |
| Callicarpa rubella f. angustata | CallicarpoideaeCallicarpa | chloroplast | 1 | 1 | OR537890OR537890.1 | Species evidence |
| Callicarpa rubella f. subglabra | CallicarpoideaeCallicarpa | chloroplast | 1 | 1 | OR537889OR537889.1 | Species evidence |
| Callicarpa siongsaiensis | CallicarpoideaeCallicarpa | chloroplast | 1 | 1 | NC_059786NC_059786.1 | Species evidence |
| Callicarpa sp XL-2023a | CallicarpoideaeCallicarpa | chloroplast | 0 | 1 | OR263673.1 | Species evidence |
| Caryopteris forrestii | AjugoideaeCaryopteris | chloroplast | 1 | 1 | NC_058325NC_058325.1 | Species evidence |
| Caryopteris incana | AjugoideaeCaryopteris | chloroplast | 1 | 1 | NC_046409NC_046409.1 | Species evidence |
| Caryopteris mongholica | AjugoideaeCaryopteris | chloroplast | 1 | 2 | NC_035729NC_035729.1 | Species evidence |
| Caryopteris tangutica | AjugoideaeCaryopteris | chloroplast | 1 | 2 | NC_069833NC_069833.1 | Species evidence |
| Caryopteris trichosphaera | AjugoideaeCaryopteris | chloroplast | 1 | 2 | MN814860MN814860.1 | Species evidence |
| Chaiturus marrubiastrum | LamioideaeChaiturus | chloroplast | 1 | 1 | PQ180372PQ180372.1 | Species evidence |
| Chelonopsis souliei | LamioideaeChelonopsis | chloroplast | 1 | 2 | NC_058326NC_058326.1 | Species evidence |
| Clerodendranthus spicatus | NepetoideaeClerodendranthus | chloroplast | 1 | 2 | NC_056393NC_056393.1 | Species evidence |
| Clerodendrum bungei | AjugoideaeClerodendrum | chloroplast | 1 | 1 | NC_056141NC_056141.1 | Species evidence |
| Clerodendrum chinense | AjugoideaeClerodendrum | chloroplast | 1 | 2 | NC_068774NC_068774.1 | Species evidence |
| Clerodendrum cyrtophyllum | AjugoideaeClerodendrum | chloroplast | 1 | 1 | MZ958825MZ958825.1 | Species evidence |
| Clerodendrum deflexum | AjugoideaeClerodendrum | chloroplast | 1 | 2 | NC_084176NC_084176.1 | Species evidence |
| Clerodendrum japonicum | AjugoideaeClerodendrum | chloroplast | 1 | 2 | NC_056260NC_056260.1 | Species evidence |
| Clerodendrum lindleyi | AjugoideaeClerodendrum | chloroplast | 1 | 2 | NC_056199NC_056199.1 | Species evidence |
| Clerodendrum mandarinorum | AjugoideaeClerodendrum | chloroplast | 1 | 2 | MN814861MN814861.1 | Species evidence |
| Clerodendrum paniculatum | AjugoideaeClerodendrum | chloroplast | 1 | 2 | NC_073114NC_073114.1 | Species evidence |
| Clerodendrum thomsoniae | AjugoideaeClerodendrum | chloroplast | 1 | 1 | NC_064126NC_064126.1 | Species evidence |
| Clerodendrum trichotomum | AjugoideaeClerodendrum | chloroplast | 1 | 2 | NC_057680NC_057680.1 | Species evidence |
| Clerodendrum yunnanense | AjugoideaeClerodendrum | chloroplast | 1 | 2 | MN814862MN814862.1 | Species evidence |
| Clinopodium abyssinicum | NepetoideaeClinopodium | chloroplast | 1 | 2 | NC_058327NC_058327.1 | Species evidence |
| Clinopodium acinos | NepetoideaeClinopodium | chloroplast | 1 | 2 | PP190943PP190943.1 | Species evidence |
| Clinopodium alpinum | NepetoideaeClinopodium | chloroplast | 1 | 2 | PP024531PP024531.1 | Species evidence |
| Clinopodium barosmum | NepetoideaeClinopodium | chloroplast | 1 | 1 | NC_085322NC_085322.1 | Species evidence |
| Clinopodium chinense | NepetoideaeClinopodium | chloroplast | 1 | 1 | NC_050943NC_050943.1 | Species evidence |
| Clinopodium euosmum | NepetoideaeClinopodium | chloroplast | 1 | 1 | NC_071895NC_071895.1 | Species evidence |
| Clinopodium menthifolium subsp. ascendens | NepetoideaeClinopodium | chloroplast | 1 | 2 | ON641271ON641271.1 | Species evidence |
| Clinopodium vulgare subsp. vulgare | NepetoideaeClinopodium | chloroplast | 1 | 2 | PP190944PP190944.1 | Species evidence |
| Coleus amboinicus | NepetoideaeColeus | chloroplast | 1 | 2 | PX923121PX923121.1 | Species evidence |
| Coleus hadiensis | NepetoideaeColeus | chloroplast | 1 | 1 | NC_069583NC_069583.1 | Species evidence |
| Colquhounia coccinea | LamioideaeColquhounia | chloroplast | 1 | 2 | NC_058329NC_058329.1 | Species evidence |
| Colquhounia coccinea var. mollis | LamioideaeColquhounia | chloroplast | 1 | 1 | MN165115MN165115.1 | Species evidence |
| Colquhounia compta | LamioideaeColquhounia | chloroplast | 1 | 2 | PQ634728PQ634728.1 | Species evidence |
| Colquhounia seguinii | LamioideaeColquhounia | chloroplast | 1 | 2 | NC_058330NC_058330.1 | Species evidence |
| Colquhounia vestita | LamioideaeColquhounia | chloroplast | 1 | 2 | NC_058331NC_058331.1 | Species evidence |
| Congea tomentosa | SymphorematoideaeCongea | chloroplast | 1 | 2 | NC_058332NC_058332.1 | Species evidence |
| Craniotome furcata | LamioideaeCraniotome | chloroplast | 1 | 1 | NC_054194NC_054194.1 | Species evidence |
| Cymaria dichotoma | CymarioideaeCymaria | chloroplast | 1 | 1 | NC_058333NC_058333.1 | Species evidence |
| Dasymalla teckiana | CallicarpoideaeDasymalla | chloroplast | 1 | 2 | NC_058334NC_058334.1 | Species evidence |
| Dicrastylis parvifolia | ProstantheroideaeDicrastylis | chloroplast | 1 | 2 | NC_058335NC_058335.1 | Species evidence |
| Dracocephalum cuspidatum | NepetoideaeDracocephalum | chloroplast | 1 | 2 | NC_079586NC_079586.1 | Species evidence |
| Dracocephalum heterophyllum | NepetoideaeDracocephalum | chloroplast | 1 | 2 | NC_068133NC_068133.1 | Species evidence |
| Dracocephalum komarovii | NepetoideaeDracocephalum | chloroplast | 1 | 2 | PX928789PX928789.1 | Species evidence |
| Dracocephalum moldavica | NepetoideaeDracocephalum | chloroplast | 1 | 2 | NC_062584NC_062584.1 | Species evidence |
| Dracocephalum officinale | NepetoideaeDracocephalum | chloroplast | 1 | 2 | NC_066037NC_066037.1 | Species evidence |
| Dracocephalum palmatum | NepetoideaeDracocephalum | chloroplast | 1 | 2 | NC_031874NC_031874.1 | Species evidence |
| Dracocephalum psammophilum | NepetoideaeDracocephalum | chloroplast | 1 | 2 | NC_061214NC_061214.1 | Species evidence |
| Dracocephalum rupestre | NepetoideaeDracocephalum | chloroplast | 1 | 2 | NC_068682NC_068682.1 | Species evidence |
| Dracocephalum ruyschiana | NepetoideaeDracocephalum | chloroplast | 1 | 1 | PQ963003PQ963003.1 | Species evidence |
| Dracocephalum seravschanicum | NepetoideaeDracocephalum | chloroplast | 1 | 2 | PX929666PX929666.1 | Species evidence |
| Dracocephalum taliense | NepetoideaeDracocephalum | chloroplast | 1 | 2 | NC_058336NC_058336.1 | Species evidence |
| Dracocephalum tanguticum | NepetoideaeDracocephalum | chloroplast | 1 | 2 | NC_057508NC_057508.1 | Species evidence |
| Elsholtzia angustifolia | NepetoideaeElsholtzia | chloroplast | 1 | 2 | NC_067948NC_067948.1 | Species evidence |
| Elsholtzia blanda | NepetoideaeElsholtzia | chloroplast | 1 | 2 | OR701859OR701859.1 | Species evidence |
| Elsholtzia bodinieri | NepetoideaeElsholtzia | chloroplast | 1 | 1 | PP357159PP357159.1 | Species evidence |
| Elsholtzia byeonsanensis | NepetoideaeElsholtzia | chloroplast | 1 | 1 | NC_064501NC_064501.1 | Species evidence |
| Elsholtzia capituligera | NepetoideaeElsholtzia | chloroplast | 1 | 1 | PP357162PP357162.1 | Species evidence |
| Elsholtzia ciliata | NepetoideaeElsholtzia | chloroplast | 1 | 2 | NC_067947NC_067947.1 | Species evidence |
| Elsholtzia cyprianii | NepetoideaeElsholtzia | chloroplast | 1 | 1 | PP357156PP357156.1 | Species evidence |
| Elsholtzia densa | NepetoideaeElsholtzia | chloroplast | 1 | 1 | NC_056994NC_056994.1 | Species evidence |
| Elsholtzia eriostachya | NepetoideaeElsholtzia | chloroplast | 1 | 2 | NC_071845NC_071845.1 | Species evidence |
| Elsholtzia fruticosa | NepetoideaeElsholtzia | chloroplast | 1 | 1 | NC_063697NC_063697.1 | Species evidence |
| Elsholtzia glabra | NepetoideaeElsholtzia | chloroplast | 1 | 1 | PP357161PP357161.1 | Species evidence |
| Elsholtzia heterophylla | NepetoideaeElsholtzia | chloroplast | 1 | 1 | PP357160PP357160.1 | Species evidence |
| Elsholtzia kachinensis | NepetoideaeElsholtzia | chloroplast | 1 | 1 | PP357165PP357165.1 | Species evidence |
| Elsholtzia minima | NepetoideaeElsholtzia | chloroplast | 1 | 2 | NC_068005NC_068005.1 | Species evidence |
| Elsholtzia myosurus | NepetoideaeElsholtzia | chloroplast | 1 | 1 | PP357155PP357155.1 | Species evidence |
| Elsholtzia pilosa | NepetoideaeElsholtzia | chloroplast | 1 | 1 | PP357163PP357163.1 | Species evidence |
| Elsholtzia rugulosa | NepetoideaeElsholtzia | chloroplast | 1 | 1 | NC_050945NC_050945.1 | Species evidence |
| Elsholtzia splendens | NepetoideaeElsholtzia | chloroplast | 1 | 1 | NC_063558NC_063558.1 | Species evidence |
| Elsholtzia stachyodes | NepetoideaeElsholtzia | chloroplast | 1 | 1 | PP357157PP357157.1 | Species evidence |
| Elsholtzia stauntonii | NepetoideaeElsholtzia | chloroplast | 1 | 1 | PP357164PP357164.1 | Species evidence |
| Eriophyton wallichii | LamioideaeEriophyton | chloroplast | 1 | 1 | NC_053828NC_053828.1 | Species evidence |
| Galeopsis bifida | LamioideaeGaleopsis | chloroplast | 1 | 2 | NC_071846NC_071846.1 | Species evidence |
| Galeopsis pubescens | LamioideaeGaleopsis | chloroplast | 1 | 2 | PP190947PP190947.1 | Species evidence |
| Galeopsis tetrahit | LamioideaeGaleopsis | chloroplast | 1 | 2 | PP190948PP190948.1 | Species evidence |
| Glechoma cf hirsuta | NepetoideaeGlechoma | chloroplast | 0 | 2 | PP203124.1 | Species evidence |
| Glechoma hederacea | NepetoideaeGlechoma | chloroplast | 1 | 2 | PP203125PP203125.1 | Species evidence |
| Glechoma hirsuta | NepetoideaeGlechoma | chloroplast | 1 | 2 | PP203126PP203126.1 | Species evidence |
| Glechoma longituba | NepetoideaeGlechoma | chloroplast | 1 | 2 | MK609928MK609928.1 | Species evidence |
| Gmelina asiatica | PremnoideaeGmelina | chloroplast | 1 | 1 | PX904544PX904544.1 | Species evidence |
| Gmelina hainanensis | PremnoideaeGmelina | chloroplast | 1 | 2 | NC_053620NC_053620.1 | Species evidence |
| Hanceola exserta | NepetoideaeHanceola | chloroplast | 1 | 1 | NC_056915NC_056915.1 | Species evidence |
| Haplostachys haplostachya | LamioideaeHaplostachys | chloroplast | 1 | 2 | NC_029819NC_029819.1 | Species evidence |
| Holmskioldia sanguinea | ScutellarioideaeHolmskioldia | chloroplast | 1 | 2 | NC_047486NC_047486.1 | Species evidence |
| Horminum pyrenaicum | NepetoideaeHorminum | chloroplast | 1 | 2 | PP165049PP165049.1 | Species evidence |
| Isodon adenanthus | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067642NC_067642.1 | Species evidence |
| Isodon albopilosus | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067643NC_067643.1 | Species evidence |
| Isodon alborubrus | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067644NC_067644.1 | Species evidence |
| Isodon angustifolius | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067645NC_067645.1 | Species evidence |
| Isodon atroruber | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067647NC_067647.1 | Species evidence |
| Isodon aurantiacus | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067648NC_067648.1 | Species evidence |
| Isodon barbeyanus | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067649NC_067649.1 | Species evidence |
| Isodon bifidocalyx | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067670NC_067670.1 | Species evidence |
| Isodon brachythyrsus | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067650NC_067650.1 | Species evidence |
| Isodon bulleyanus | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067651NC_067651.1 | Species evidence |
| Isodon calcicola | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067652NC_067652.1 | Species evidence |
| Isodon chionanthus | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067706NC_067706.1 | Species evidence |
| Isodon coetsa | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067646NC_067646.1 | Species evidence |
| Isodon coetsa var. cavaleriei | NepetoideaeIsodon | chloroplast | 1 | 2 | ON858844ON858844.1 | Species evidence |
| Isodon coetsa var. coetsa | NepetoideaeIsodon | chloroplast | 1 | 2 | ON858843ON858843.1 | Species evidence |
| Isodon coetsoides | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067653NC_067653.1 | Species evidence |
| Isodon dawoensis | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067654NC_067654.1 | Species evidence |
| Isodon delavayi | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067655NC_067655.1 | Species evidence |
| Isodon effusus | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067694NC_067694.1 | Species evidence |
| Isodon enanderianus | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067656NC_067656.1 | Species evidence |
| Isodon eriocalyx | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067779NC_067779.1 | Species evidence |
| Isodon excisoides | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067657NC_067657.1 | Species evidence |
| Isodon excisus | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067780NC_067780.1 | Species evidence |
| Isodon flabelliformis | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067696NC_067696.1 | Species evidence |
| Isodon flavidus | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067658NC_067658.1 | Species evidence |
| Isodon flexicaulis | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067701NC_067701.1 | Species evidence |
| Isodon forrestii | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067659NC_067659.1 | Species evidence |
| Isodon gibbosus | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067660NC_067660.1 | Species evidence |
| Isodon grandifolius var. atuntzeensis | NepetoideaeIsodon | chloroplast | 1 | 2 | ON858856ON858856.1 | Species evidence |
| Isodon grandifolius var. grandifolius | NepetoideaeIsodon | chloroplast | 1 | 2 | ON858868ON858868.1 | Species evidence |
| Isodon hirtellus | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067661NC_067661.1 | Species evidence |
| Isodon hsiwenii | NepetoideaeIsodon | chloroplast | 1 | 2 | ON858858ON858858.1 | Species evidence |
| Isodon inflexus | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067781NC_067781.1 | Species evidence |
| Isodon interruptus | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067662NC_067662.1 | Species evidence |
| Isodon irroratus | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067663NC_067663.1 | Species evidence |
| Isodon japonicus | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067782NC_067782.1 | Species evidence |
| Isodon japonicus var. glaucocalyx | NepetoideaeIsodon | chloroplast | 1 | 2 | ON858864ON858864.1 | Species evidence |
| Isodon japonicus var. japonicus | NepetoideaeIsodon | chloroplast | 1 | 2 | ON858903ON858903.1 | Species evidence |
| Isodon kangtingensis | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067664NC_067664.1 | Species evidence |
| Isodon leucophyllus | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067665NC_067665.1 | Species evidence |
| Isodon longitubus | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067695NC_067695.1 | Species evidence |
| Isodon lophanthoides | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067783NC_067783.1 | Species evidence |
| Isodon lophanthoides var. graciliflorus | NepetoideaeIsodon | chloroplast | 1 | 2 | ON858870ON858870.1 | Species evidence |
| Isodon loxothyrsus | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067667NC_067667.1 | Species evidence |
| Isodon lungshengensis | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067668NC_067668.1 | Species evidence |
| Isodon macrocalyx | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067666NC_067666.1 | Species evidence |
| Isodon macrophyllus | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067669NC_067669.1 | Species evidence |
| Isodon medilungensis | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067705NC_067705.1 | Species evidence |
| Isodon megathyrsus | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067671NC_067671.1 | Species evidence |
| Isodon mucronatus | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067704NC_067704.1 | Species evidence |
| Isodon muliensis | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067700NC_067700.1 | Species evidence |
| Isodon nervosus | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_058575NC_058575.1 | Species evidence |
| Isodon oreophilus | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067672NC_067672.1 | Species evidence |
| Isodon oresbius | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067673NC_067673.1 | Species evidence |
| Isodon parvifolius | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067674NC_067674.1 | Species evidence |
| Isodon pharicus | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067675NC_067675.1 | Species evidence |
| Isodon phyllopodus | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067707NC_067707.1 | Species evidence |
| Isodon phyllostachys | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067677NC_067677.1 | Species evidence |
| Isodon pleiophyllus | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067678NC_067678.1 | Species evidence |
| Isodon polystachys | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067697NC_067697.1 | Species evidence |
| Isodon racemosus | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067698NC_067698.1 | Species evidence |
| Isodon ramosissimus | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067709NC_067709.1 | Species evidence |
| Isodon rosthornii | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067699NC_067699.1 | Species evidence |
| Isodon rubescens | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_053708NC_053708.1 | Species evidence |
| Isodon rugosiformis | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067679NC_067679.1 | Species evidence |
| Isodon rugosus | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067680NC_067680.1 | Species evidence |
| Isodon schimperi | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067708NC_067708.1 | Species evidence |
| Isodon scoparius | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067681NC_067681.1 | Species evidence |
| Isodon scrophularioides | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067682NC_067682.1 | Species evidence |
| Isodon sculponeatus | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067683NC_067683.1 | Species evidence |
| Isodon secundiflorus | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067703NC_067703.1 | Species evidence |
| Isodon serra | NepetoideaeIsodon | chloroplast | 1 | 1 | NC_064127NC_064127.1 | Species evidence |
| Isodon setschwanensis | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067702NC_067702.1 | Species evidence |
| Isodon shikokianus var. occidentalis | NepetoideaeIsodon | chloroplast | 1 | 2 | ON858908ON858908.1 | Species evidence |
| Isodon smithianus | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067684NC_067684.1 | Species evidence |
| Isodon sp CL-2021 | NepetoideaeIsodon | chloroplast | 0 | 2 | MW940491.1 | Species evidence |
| Isodon tenuifolius | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067685NC_067685.1 | Species evidence |
| Isodon ternifolius | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067686NC_067686.1 | Species evidence |
| Isodon trichocarpus | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067693NC_067693.1 | Species evidence |
| Isodon umbrosus var. leucanthus | NepetoideaeIsodon | chloroplast | 1 | 2 | ON858906ON858906.1 | Species evidence |
| Isodon villosus | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067687NC_067687.1 | Species evidence |
| Isodon wardii | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067688NC_067688.1 | Species evidence |
| Isodon weisiensis | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067689NC_067689.1 | Species evidence |
| Isodon wikstroemioides | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067690NC_067690.1 | Species evidence |
| Isodon xerophilus | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067692NC_067692.1 | Species evidence |
| Isodon yuennanensis | NepetoideaeIsodon | chloroplast | 1 | 2 | NC_067691NC_067691.1 | Species evidence |
| Lagochilus bungei | LamioideaeLagochilus | chloroplast | 1 | 1 | PQ180373PQ180373.1 | Species evidence |
| Lagochilus diacanthophyllus | LamioideaeLagochilus | chloroplast | 1 | 1 | PQ180377PQ180377.1 | Species evidence |
| Lagochilus grandiflorus | LamioideaeLagochilus | chloroplast | 1 | 1 | PQ180378PQ180378.1 | Species evidence |
| Lagochilus hirtus | LamioideaeLagochilus | chloroplast | 1 | 1 | PQ180379PQ180379.1 | Species evidence |
| Lagochilus ilicifolius | LamioideaeLagochilus | chloroplast | 1 | 2 | NC_067785NC_067785.1 | Species evidence |
| Lagochilus inebrians | LamioideaeLagochilus | chloroplast | 1 | 2 | PV192925PV192925.1 | Species evidence |
| Lagochilus lanatonodus | LamioideaeLagochilus | chloroplast | 1 | 1 | PQ180381PQ180381.1 | Species evidence |
| Lagochilus platyacanthus | LamioideaeLagochilus | chloroplast | 1 | 1 | PQ231080PQ231080.1 | Species evidence |
| Lagochilus seravschanicus | LamioideaeLagochilus | chloroplast | 1 | 2 | PQ126530PQ126530.1 | Species evidence |
| Lagochilus sp | LamioideaeLagochilus | chloroplast | 0 | 1 | PQ279583.1 | Species evidence |
| Lagochilus vvedenskyi | LamioideaeLagochilus | chloroplast | 1 | 2 | PQ126531PQ126531.1 | Species evidence |
| Lagopsis darwiniana | LamioideaeLagopsis | chloroplast | 1 | 1 | PX283822PX283822.1 | Species evidence |
| Lagopsis eriostachya | LamioideaeLagopsis | chloroplast | 1 | 1 | PQ231082PQ231082.1 | Species evidence |
| Lagopsis flava | LamioideaeLagopsis | chloroplast | 1 | 1 | PQ231086PQ231086.1 | Species evidence |
| Lamiaceae sp MQ-2024a | LamioideaeLamiaceae | chloroplast | 0 | 1 | PQ414921.1 | Species evidence |
| Lamium album | LamioideaeLamium | chloroplast | 1 | 1 | OR565909OR565909.1 | Species evidence |
| Lamium album subsp. album | LamioideaeLamium | chloroplast | 1 | 2 | PP203135PP203135.1 | Species evidence |
| Lamium amplexicaule | LamioideaeLamium | chloroplast | 1 | 1 | PQ231089PQ231089.1 | Species evidence |
| Lamium barbatum | LamioideaeLamium | chloroplast | 1 | 1 | PV802395PV802395.1 | Species evidence |
| Lamium galeobdolon subsp. flavidum | LamioideaeLamium | chloroplast | 1 | 2 | PP203136PP203136.1 | Species evidence |
| Lamium orvala | LamioideaeLamium | chloroplast | 1 | 2 | PP336767PP336767.1 | Species evidence |
| Lamium purpureum | LamioideaeLamium | chloroplast | 1 | 1 | PZ055112PZ055112.1 | Species evidence |
| Lamium takeshimense | LamioideaeLamium | chloroplast | 1 | 2 | MN240520MN240520.1 | Species evidence |
| Lavandula angustifolia | NepetoideaeLavandula | chloroplast | 1 | 1 | NC_029370NC_029370.1 | Species evidence |
| Lavandula dentata | NepetoideaeLavandula | chloroplast | 1 | 1 | NC_046835NC_046835.1 | Species evidence |
| Lavandula maroccana | NepetoideaeLavandula | chloroplast | 1 | 1 | PX569468PX569468.1 | Species evidence |
| Lavandula pedunculata subsp. lusitanica | NepetoideaeLavandula | chloroplast | 1 | 2 | ON641259ON641259.1 | Species evidence |
| Lavandula stoechas subsp. luisieri | NepetoideaeLavandula | chloroplast | 1 | 2 | ON641264ON641264.1 | Species evidence |
| Leonotis leonurus | LamioideaeLeonotis | chloroplast | 1 | 2 | NC_086629NC_086629.1 | Species evidence |
| Leonurus cardiaca | LamioideaeLeonurus | chloroplast | 1 | 2 | NC_058592NC_058592.1 | Species evidence |
| Leonurus japonicus | LamioideaeLeonurus | chloroplast | 0 | 2 | NC_038062.1 | Species evidence |
| Leonurus panzerioides | LamioideaeLeonurus | chloroplast | 1 | 1 | PQ231095PQ231095.1 | Species evidence |
| Leonurus turkestanicus | LamioideaeLeonurus | chloroplast | 1 | 1 | PQ231098PQ231098.1 | Species evidence |
| Lepechinia chamaedryoides | NepetoideaeLepechinia | chloroplast | 1 | 2 | NC_084051NC_084051.1 | Species evidence |
| Leucas ciliata | LamioideaeLeucas | chloroplast | 1 | 1 | PV802396PV802396.1 | Species evidence |
| Leucas mollissima | LamioideaeLeucas | chloroplast | 1 | 1 | OR565912OR565912.1 | Species evidence |
| Leucosceptrum canum | LamioideaeLeucosceptrum | chloroplast | 1 | 1 | NC_051966NC_051966.1 | Species evidence |
| Loxocalyx urticifolius | LamioideaeLoxocalyx | chloroplast | 1 | 1 | PQ231101PQ231101.1 | Species evidence |
| Lycopus europaeus | NepetoideaeLycopus | chloroplast | 1 | 1 | NC_064128NC_064128.1 | Species evidence |
| Lycopus lucidus | NepetoideaeLycopus | chloroplast | 1 | 2 | PV558881PV558881.1 | Species evidence |
| Lycopus lucidus var. hirtus | NepetoideaeLycopus | chloroplast | 1 | 2 | MT980792MT980792.1 | Species evidence |
| Marmoritis complanata | NepetoideaeMarmoritis | chloroplast | 1 | 2 | NC_071847NC_071847.1 | Species evidence |
| Marrubium vulgare | LamioideaeMarrubium | chloroplast | 1 | 1 | PQ231104PQ231104.1 | Species evidence |
| Matsumurella chinensis | LamioideaeMatsumurella | chloroplast | 1 | 1 | PP056237PP056237.1 | Species evidence |
| Matsumurella kwangtungensis | LamioideaeMatsumurella | chloroplast | 1 | 1 | OR565917OR565917.1 | Species evidence |
| Matsumurella szechuanensis | LamioideaeMatsumurella | chloroplast | 1 | 1 | OR565952OR565952.1 | Species evidence |
| Matsumurella tuberifera | LamioideaeMatsumurella | chloroplast | 1 | 1 | OR565964OR565964.1 | Species evidence |
| Matsumurella yangsoensis | LamioideaeMatsumurella | chloroplast | 1 | 1 | OR565945OR565945.1 | Species evidence |
| Meehania henryi | NepetoideaeMeehania | chloroplast | 1 | 1 | OP204791OP204791.1 | Species evidence |
| Melissa officinalis | NepetoideaeMelissa | chloroplast | 1 | 2 | NC_066033NC_066033.1 | Species evidence |
| Melittis melissophyllum subsp. melissophyllum | LamioideaeMelittis | chloroplast | 1 | 2 | PP165060PP165060.1 | Species evidence |
| Mentha aquatica | NepetoideaeMentha | chloroplast | 1 | 1 | PV600640PV600640.1 | Species evidence |
| Mentha arvensis | NepetoideaeMentha | chloroplast | 1 | 1 | PX971240PX971240.1 | Species evidence |
| Mentha canadensis | NepetoideaeMentha | chloroplast | 1 | 2 | NC_044082NC_044082.1 | Species evidence |
| Mentha longifolia | NepetoideaeMentha | chloroplast | 1 | 2 | NC_032054NC_032054.1 | Species evidence |
| Mentha pulegium | NepetoideaeMentha | chloroplast | 1 | 2 | NC_086489NC_086489.1 | Species evidence |
| Mentha sp Snogerup 10996 | NepetoideaeMentha | chloroplast | 0 | 1 | PX971241.1 | Species evidence |
| Mentha sp Svensson Wigermo 20766 | NepetoideaeMentha | chloroplast | 0 | 1 | PX971242.1 | Species evidence |
| Mentha spicata | NepetoideaeMentha | chloroplast | 1 | 2 | NC_037247NC_037247.1 | Species evidence |
| Mentha suaveolens | NepetoideaeMentha | chloroplast | 1 | 2 | NC_086486NC_086486.1 | Species evidence |
| Mentha x piperita | NepetoideaeMentha | chloroplast | 1 | 2 | NC_047475NC_047475.1 | Species evidence |
| Mentha x rotundifolia | NepetoideaeMentha | chloroplast | 1 | 1 | PX971243PX971243.1 | Species evidence |
| Mentha x verticillata | NepetoideaeMentha | chloroplast | 1 | 2 | NC_063687NC_063687.1 | Species evidence |
| Mentha x villosa | NepetoideaeMentha | chloroplast | 1 | 1 | NC_071750NC_071750.1 | Species evidence |
| Mesosphaerum suaveolens | NepetoideaeMesosphaerum | chloroplast | 1 | 1 | PX969653PX969653.1 | Species evidence |
| Monarda didyma | NepetoideaeMonarda | chloroplast | 1 | 1 | PX394257PX394257.1 | Species evidence |
| Mosla cavaleriei | NepetoideaeMosla | chloroplast | 1 | 1 | PZ101810PZ101810.1 | Species evidence |
| Mosla chinensis | NepetoideaeMosla | chloroplast | 1 | 1 | PP357188.1PZ101788 | Species evidence |
| Mosla dianthera | NepetoideaeMosla | chloroplast | 1 | 1 | PZ101792PZ101792.1 | Species evidence |
| Mosla hangchowensis | NepetoideaeMosla | chloroplast | 1 | 1 | PZ101804PZ101804.1 | Species evidence |
| Mosla japonica | NepetoideaeMosla | chloroplast | 1 | 1 | PZ101799PZ101799.1 | Species evidence |
| Mosla longibracteata | NepetoideaeMosla | chloroplast | 1 | 1 | PZ101811PZ101811.1 | Species evidence |
| Mosla longispica | NepetoideaeMosla | chloroplast | 1 | 1 | PZ101803PZ101803.1 | Species evidence |
| Mosla pauciflora | NepetoideaeMosla | chloroplast | 1 | 1 | PZ101796PZ101796.1 | Species evidence |
| Mosla scabra | NepetoideaeMosla | chloroplast | 1 | 1 | PZ101809PZ101809.1 | Species evidence |
| Mosla soochowensis | NepetoideaeMosla | chloroplast | 1 | 1 | PZ101794PZ101794.1 | Species evidence |
| Mosla tamdaoensis | NepetoideaeMosla | chloroplast | 1 | 1 | PZ101797PZ101797.1 | Species evidence |
| Nepeta bracteata | NepetoideaeNepeta | chloroplast | 1 | 1 | NC_079688NC_079688.1 | Species evidence |
| Nepeta cataria | NepetoideaeNepeta | chloroplast | 1 | 1 | NC_051544NC_051544.1 | Species evidence |
| Nepeta dentata | NepetoideaeNepeta | chloroplast | 1 | 2 | NC_071848NC_071848.1 | Species evidence |
| Nepeta hemsleyana | NepetoideaeNepeta | chloroplast | 1 | 2 | NC_058882NC_058882.1 | Species evidence |
| Nepeta laevigata | NepetoideaeNepeta | chloroplast | 1 | 2 | NC_071849NC_071849.1 | Species evidence |
| Nepeta nuda | NepetoideaeNepeta | chloroplast | 1 | 1 | PV930134PV930134.1 | Species evidence |
| Nepeta santoana | NepetoideaeNepeta | chloroplast | 1 | 2 | PV837617PV837617.1 | Species evidence |
| Nepeta stewartiana | NepetoideaeNepeta | chloroplast | 1 | 2 | NC_057283NC_057283.1 | Species evidence |
| Nepeta thomsonii | NepetoideaeNepeta | chloroplast | 1 | 2 | NC_071850NC_071850.1 | Species evidence |
| Ocimum americanum | NepetoideaeOcimum | chloroplast | 1 | 2 | NC_079695NC_079695.1 | Species evidence |
| Ocimum basilicum | NepetoideaeOcimum | chloroplast | 1 | 2 | NC_035143PZ530182.1 | Species evidence |
| Ocimum basilicum var. basilicum | NepetoideaeOcimum | chloroplast | 1 | 2 | OQ706275OQ706275.1 | Species evidence |
| Ocimum basilicum var. purpurascens | NepetoideaeOcimum | chloroplast | 1 | 2 | OR478166OR478166.1 | Species evidence |
| Ocimum gratissimum | NepetoideaeOcimum | chloroplast | 1 | 2 | NC_057196NC_057196.1 | Species evidence |
| Ocimum kilimandscharicum | NepetoideaeOcimum | chloroplast | 1 | 2 | MW829603MW829603.2 | Species evidence |
| Ocimum tenuiflorum | NepetoideaeOcimum | chloroplast | 1 | 2 | NC_043873NC_043873.1 | Species evidence |
| Ocimum x africanum | NepetoideaeOcimum | chloroplast | 1 | 2 | NC_082140NC_082140.1 | Species evidence |
| Origanum vulgare | NepetoideaeOriganum | chloroplast | 1 | 2 | PQ468695PQ468695.1 | Species evidence |
| Origanum vulgare subsp. virens | NepetoideaeOriganum | chloroplast | 1 | 2 | ON641292ON641292.1 | Species evidence |
| Origanum vulgare subsp. vulgare | NepetoideaeOriganum | chloroplast | 1 | 2 | ON641323ON641323.1 | Species evidence |
| Orthosiphon aristatus | NepetoideaeOrthosiphon | chloroplast | 1 | 1 | NC_082580NC_082580.1 | Species evidence |
| Panzerina lanata | LamioideaePanzerina | chloroplast | 1 | 1 | PQ279582PQ279582.1 | Species evidence |
| Paraleonurus chaituroides | LamioideaeParaleonurus | chloroplast | 1 | 1 | PQ231090PQ231090.1 | Species evidence |
| Paraleonurus japonicus | LamioideaeParaleonurus | — | 1 | 0 | NC_038062 | Species evidence |
| Paraleonurus pseudomacranthus | LamioideaeParaleonurus | chloroplast | 1 | 1 | PQ231096PQ231096.1 | Species evidence |
| Paraleonurus sibiricus | LamioideaeParaleonurus | chloroplast | 1 | 2 | NC_067787NC_067787.1 | Species evidence |
| Paraphlomis albida var. albida | LamioideaeParaphlomis | chloroplast | 1 | 1 | OR565920OR565920.1 | Species evidence |
| Paraphlomis albida var. brevidens | LamioideaeParaphlomis | chloroplast | 1 | 1 | OR565938OR565938.1 | Species evidence |
| Paraphlomis albiflora | LamioideaeParaphlomis | chloroplast | 1 | 1 | OR565954OR565954.1 | Species evidence |
| Paraphlomis albiflora var. biflora | LamioideaeParaphlomis | chloroplast | 1 | 1 | OR565950OR565950.1 | Species evidence |
| Paraphlomis albotomentosa | LamioideaeParaphlomis | chloroplast | 1 | 1 | OR565962OR565962.1 | Species evidence |
| Paraphlomis caloneura | LamioideaeParaphlomis | chloroplast | 1 | 1 | OR565942OR565942.1 | Species evidence |
| Paraphlomis coronata | LamioideaeParaphlomis | chloroplast | 1 | 1 | OR565918OR565918.1 | Species evidence |
| Paraphlomis foliata | LamioideaeParaphlomis | chloroplast | 1 | 1 | OR565957OR565957.1 | Species evidence |
| Paraphlomis foliata subsp. montigena | LamioideaeParaphlomis | chloroplast | 1 | 1 | OR565931OR565931.1 | Species evidence |
| Paraphlomis formosana | LamioideaeParaphlomis | chloroplast | 1 | 1 | OR565953OR565953.1 | Species evidence |
| Paraphlomis gracilis | LamioideaeParaphlomis | chloroplast | 1 | 1 | OR565927OR565927.1 | Species evidence |
| Paraphlomis gracilis var. lutienensis | LamioideaeParaphlomis | chloroplast | 1 | 1 | OR565930OR565930.1 | Species evidence |
| Paraphlomis hirsutissima | LamioideaeParaphlomis | chloroplast | 1 | 1 | OR565958OR565958.1 | Species evidence |
| Paraphlomis hispida | LamioideaeParaphlomis | chloroplast | 1 | 1 | PQ231107PQ231107.1 | Species evidence |
| Paraphlomis intermedia | LamioideaeParaphlomis | chloroplast | 1 | 1 | OR565934OR565934.1 | Species evidence |
| Paraphlomis javanica | LamioideaeParaphlomis | chloroplast | 1 | 1 | NC_085355NC_085355.1 | Species evidence |
| Paraphlomis javanica var. pteropoda | LamioideaeParaphlomis | chloroplast | 1 | 1 | OR565943OR565943.1 | Species evidence |
| Paraphlomis jinggangshanensis | LamioideaeParaphlomis | chloroplast | 1 | 1 | OR565956OR565956.1 | Species evidence |
| Paraphlomis koreana | LamioideaeParaphlomis | chloroplast | 1 | 2 | NC_058605NC_058605.1 | Species evidence |
| Paraphlomis kuankuoshuiensis | LamioideaeParaphlomis | chloroplast | 1 | 1 | OR565939OR565939.1 | Species evidence |
| Paraphlomis kwangtungensis | LamioideaeParaphlomis | chloroplast | 1 | 1 | OR565963OR565963.1 | Species evidence |
| Paraphlomis lanceolata | LamioideaeParaphlomis | chloroplast | 1 | 1 | OR565955OR565955.1 | Species evidence |
| Paraphlomis lancidentata | LamioideaeParaphlomis | chloroplast | 1 | 1 | OR565935OR565935.1 | Species evidence |
| Paraphlomis longicalyx | LamioideaeParaphlomis | chloroplast | 1 | 1 | OR565925OR565925.1 | Species evidence |
| Paraphlomis membranacea | LamioideaeParaphlomis | chloroplast | 1 | 1 | OR565959OR565959.1 | Species evidence |
| Paraphlomis nana | LamioideaeParaphlomis | chloroplast | 1 | 1 | OR565913OR565913.1 | Species evidence |
| Paraphlomis patentisetulosa | LamioideaeParaphlomis | chloroplast | 1 | 1 | OR565932OR565932.1 | Species evidence |
| Paraphlomis paucisetosa | LamioideaeParaphlomis | chloroplast | 1 | 1 | OR565915OR565915.1 | Species evidence |
| Paraphlomis reflexa | LamioideaeParaphlomis | chloroplast | 1 | 1 | OR565944OR565944.1 | Species evidence |
| Paraphlomis seticalyx | LamioideaeParaphlomis | chloroplast | 1 | 1 | OR565940OR565940.1 | Species evidence |
| Paraphlomis setulosa | LamioideaeParaphlomis | chloroplast | 1 | 1 | OR565960OR565960.1 | Species evidence |
| Paraphlomis sp T75192-1 | LamioideaeParaphlomis | chloroplast | 0 | 1 | PX682502.1 | Species evidence |
| Paraphlomis sp YC-2025b | LamioideaeParaphlomis | chloroplast | 0 | 1 | PV741117.1 | Species evidence |
| Paraphlomis strictiflora | LamioideaeParaphlomis | chloroplast | 1 | 1 | OR565937OR565937.1 | Species evidence |
| Paraphlomis yingdeensis | LamioideaeParaphlomis | chloroplast | 1 | 1 | OR565948OR565948.1 | Species evidence |
| Perilla frutescens | NepetoideaePerilla | chloroplast | 1 | 1 | NC_030755OR567250.1 | Species evidence |
| Perilla frutescens f. crispidiscolor | NepetoideaePerilla | chloroplast | 1 | 2 | KT220686KT220686.1 | Species evidence |
| Perilla frutescens var. acuta | NepetoideaePerilla | chloroplast | 1 | 2 | KT220685KT220685.1 | Species evidence |
| Perilla frutescens var. crispa | NepetoideaePerilla | chloroplast | 1 | 2 | KT220688KT220688.1 | Species evidence |
| Perilla frutescens var. frutescens | NepetoideaePerilla | chloroplast | 1 | 2 | KT220689KT220689.1 | Species evidence |
| Perilla frutescens var. hirtella | NepetoideaePerilla | chloroplast | 1 | 2 | NC_030757NC_030757.1 | Species evidence |
| Peronema canescens | PeronematoideaePeronema | — | 1 | 0 | OK064490.1 | Species evidence |
| Phlomis fruticosa | LamioideaePhlomis | chloroplast | 1 | 2 | NC_065868NC_065868.1 | Species evidence |
| Phlomoides alpina | LamioideaePhlomoides | chloroplast | 1 | 2 | MN814865MN814865.1 | Species evidence |
| Phlomoides anisochila | LamioideaePhlomoides | chloroplast | 1 | 2 | PV929680PV929680.1 | Species evidence |
| Phlomoides betonicoides | LamioideaePhlomoides | chloroplast | 1 | 2 | OP186467OP186467.1 | Species evidence |
| Phlomoides hamosa | LamioideaePhlomoides | chloroplast | 1 | 2 | NC_061415NC_061415.1 | Species evidence |
| Phlomoides isochila | LamioideaePhlomoides | chloroplast | 1 | 2 | PX921649PX921649.1 | Species evidence |
| Phlomoides kirghisorum | LamioideaePhlomoides | chloroplast | 1 | 2 | NC_067634NC_067634.1 | Species evidence |
| Phlomoides megalantha | LamioideaePhlomoides | chloroplast | 1 | 1 | NC_085356NC_085356.1 | Species evidence |
| Phlomoides ornata | LamioideaePhlomoides | chloroplast | 1 | 1 | NC_085357NC_085357.1 | Species evidence |
| Phlomoides rotata | LamioideaePhlomoides | chloroplast | 1 | 2 | NC_065733NC_065733.1 | Species evidence |
| Phlomoides strigosa | LamioideaePhlomoides | chloroplast | 1 | 2 | NC_070070NC_070070.1 | Species evidence |
| Phlomoides szechuanensis | LamioideaePhlomoides | chloroplast | 1 | 1 | NC_085358NC_085358.1 | Species evidence |
| Phlomoides tatsienensis | LamioideaePhlomoides | chloroplast | 1 | 1 | NC_085359NC_085359.1 | Species evidence |
| Phlomoides tuberosa | LamioideaePhlomoides | chloroplast | 1 | 1 | OR565910OR565910.1 | Species evidence |
| Phlomoides umbrosa | LamioideaePhlomoides | chloroplast | 1 | 2 | NC_061394NC_061394.1 | Species evidence |
| Phlomoides younghusbandii | LamioideaePhlomoides | chloroplast | 1 | 1 | PP234524PP234524.1 | Species evidence |
| Phyllostegia velutina | LamioideaePhyllostegia | chloroplast | 1 | 2 | NC_029820NC_029820.1 | Species evidence |
| Physostegia virginiana | LamioideaePhysostegia | chloroplast | 1 | 2 | NC_085368NC_085368.1 | Species evidence |
| Platostoma chinense | NepetoideaePlatostoma | chloroplast | 1 | 2 | MT328397MT328397.1 | Species evidence |
| Platostoma palustre | NepetoideaePlatostoma | chloroplast | 1 | 1 | PV476682PV476682.1 | Species evidence |
| Plectranthus barbatus | NepetoideaePlectranthus | chloroplast | 1 | 2 | NC_066019NC_066019.1 | Species evidence |
| Pogostemon cablin | LamioideaePogostemon | chloroplast | 1 | 1 | NC_042796NC_042796.1 | Species evidence |
| Pogostemon plectranthoides | LamioideaePogostemon | chloroplast | 1 | 1 | NC_065983NC_065983.1 | Species evidence |
| Pogostemon septentrionalis | LamioideaePogostemon | chloroplast | 1 | 1 | NC_065984NC_065984.1 | Species evidence |
| Pogostemon stellatus | LamioideaePogostemon | chloroplast | 1 | 2 | NC_031434NC_031434.1 | Species evidence |
| Pogostemon yatabeanus | LamioideaePogostemon | chloroplast | 1 | 2 | NC_031433NC_031433.1 | Species evidence |
| Premna microphylla | PremnoideaePremna | chloroplast | 1 | 2 | NC_026291NC_026291.1 | Species evidence |
| Premna puberula | PremnoideaePremna | chloroplast | 1 | 1 | NC_061379NC_061379.1 | Species evidence |
| Prostanthera althoferi subsp. althoferi | ProstantheroideaeProstanthera | chloroplast | 1 | 3 | OR699050OR699050.1 | Species evidence |
| Prostanthera althoferi x Prostanthera campbellii | ProstantheroideaeProstanthera | chloroplast | 1 | 3 | NC_084413NC_084413.1 | Species evidence |
| Prostanthera campbellii | ProstantheroideaeProstanthera | chloroplast | 1 | 3 | NC_084414NC_084414.1 | Species evidence |
| Prostanthera wilkieana | ProstantheroideaeProstanthera | chloroplast | 1 | 3 | NC_084412NC_084412.1 | Species evidence |
| Prunella vulgaris | NepetoideaePrunella | chloroplast | 1 | 2 | NC_039654NC_039654.1 | Species evidence |
| Prunella vulgaris subsp. vulgaris | NepetoideaePrunella | chloroplast | 1 | 2 | PP272174PP272174.1 | Species evidence |
| Pseudocaryopteris paniculata | AjugoideaePseudocaryopteris | chloroplast | 1 | 2 | MN814866MN814866.1 | Species evidence |
| Pycnostachys reticulata | NepetoideaePycnostachys | chloroplast | 1 | 2 | MT740257MT740257.1 | Species evidence |
| Rotheca myricoides | AjugoideaeRotheca | chloroplast | 1 | 2 | NC_059906NC_059906.1 | Species evidence |
| Rotheca serrata | AjugoideaeRotheca | chloroplast | 1 | 2 | MN814867MN814867.1 | Species evidence |
| Salvia adenophora | NepetoideaeSalvia | chloroplast | 1 | 2 | MT156363MT156363.1 | Species evidence |
| Salvia aerea | NepetoideaeSalvia | chloroplast | 1 | 2 | NC_067739NC_067739.1 | Species evidence |
| Salvia aethiopis | NepetoideaeSalvia | chloroplast | 1 | 1 | PV870855PV870855.1 | Species evidence |
| Salvia amarissima | NepetoideaeSalvia | chloroplast | 1 | 1 | PV870856PV870856.1 | Species evidence |
| Salvia apiana | NepetoideaeSalvia | chloroplast | 1 | 2 | NC_084049NC_084049.1 | Species evidence |
| Salvia azurea | NepetoideaeSalvia | chloroplast | 1 | 2 | MT156371MT156371.1 | Species evidence |
| Salvia bowleyana | NepetoideaeSalvia | chloroplast | 1 | 1 | NC_063911NC_063911.1 | Species evidence |
| Salvia brandegeei | NepetoideaeSalvia | chloroplast | 1 | 1 | PX971244PX971244.1 | Species evidence |
| Salvia bucharica | NepetoideaeSalvia | chloroplast | 1 | 2 | PV601297PV601297.1 | Species evidence |
| Salvia bulleyana | NepetoideaeSalvia | chloroplast | 1 | 2 | NC_041092NC_041092.1 | Species evidence |
| Salvia campanulata | NepetoideaeSalvia | chloroplast | 1 | 2 | NC_057284NC_057284.1 | Species evidence |
| Salvia castanea | NepetoideaeSalvia | chloroplast | 1 | 2 | NC_067740NC_067740.1 | Species evidence |
| Salvia castanea f. tomentosa | NepetoideaeSalvia | chloroplast | 1 | 2 | MW387501MW387501.1 | Species evidence |
| Salvia chanryoenica | NepetoideaeSalvia | chloroplast | 1 | 2 | NC_040121NC_040121.1 | Species evidence |
| Salvia chienii | NepetoideaeSalvia | chloroplast | 1 | 1 | OK094518OK094518.1 | Species evidence |
| Salvia chinensis | NepetoideaeSalvia | chloroplast | 1 | 1 | PV591959PV591959.1 | Species evidence |
| Salvia clevelandii | NepetoideaeSalvia | chloroplast | 1 | 1 | PX971245PX971245.1 | Species evidence |
| Salvia columbariae | NepetoideaeSalvia | chloroplast | 1 | 1 | PX971246PX971246.1 | Species evidence |
| Salvia curviflora | NepetoideaeSalvia | chloroplast | 1 | 2 | MT156364MT156364.1 | Species evidence |
| Salvia dabieshanensis | NepetoideaeSalvia | chloroplast | 1 | 1 | NC_063912NC_063912.1 | Species evidence |
| Salvia daiguii | NepetoideaeSalvia | chloroplast | 1 | 2 | NC_059718NC_059718.1 | Species evidence |
| Salvia deserta | NepetoideaeSalvia | chloroplast | 1 | 2 | NC_084045NC_084045.1 | Species evidence |
| Salvia digitaloides | NepetoideaeSalvia | chloroplast | 1 | 2 | NC_050895NC_050895.1 | Species evidence |
| Salvia dorrii | NepetoideaeSalvia | chloroplast | 1 | 1 | PV870857PV870857.1 | Species evidence |
| Salvia dorystaechas | NepetoideaeSalvia | chloroplast | 1 | 2 | NC_084050NC_084050.1 | Species evidence |
| Salvia eremostachya | NepetoideaeSalvia | chloroplast | 1 | 1 | PV870858PV870858.1 | Species evidence |
| Salvia farinacea | NepetoideaeSalvia | chloroplast | 1 | 1 | PQ359435PQ359435.1 | Species evidence |
| Salvia forsskaolei | NepetoideaeSalvia | chloroplast | 1 | 2 | NC_084047NC_084047.1 | Species evidence |
| Salvia fruticosa | NepetoideaeSalvia | chloroplast | 1 | 1 | PV870859PV870859.1 | Species evidence |
| Salvia glabrescens | NepetoideaeSalvia | chloroplast | 1 | 2 | NC_067735NC_067735.1 | Species evidence |
| Salvia glutinosa | NepetoideaeSalvia | chloroplast | 1 | 2 | NC_067736NC_067736.1 | Species evidence |
| Salvia grandifolia | NepetoideaeSalvia | chloroplast | 1 | 2 | NC_084046NC_084046.1 | Species evidence |
| Salvia guidongensis | NepetoideaeSalvia | chloroplast | 1 | 1 | OR767373OR767373.1 | Species evidence |
| Salvia hispanica | NepetoideaeSalvia | chloroplast | 1 | 1 | NC_046838NC_046838.1 | Species evidence |
| Salvia honania | NepetoideaeSalvia | chloroplast | 1 | 1 | NC_058852NC_058852.1 | Species evidence |
| Salvia huberi | NepetoideaeSalvia | chloroplast | 1 | 1 | PV870860PV870860.1 | Species evidence |
| Salvia insignis | NepetoideaeSalvia | chloroplast | 1 | 2 | PV972776PV972776.1 | Species evidence |
| Salvia iodantha | NepetoideaeSalvia | chloroplast | 1 | 2 | MT156366MT156366.1 | Species evidence |
| Salvia japonica | NepetoideaeSalvia | chloroplast | 1 | 1 | NC_035233NC_035233.1 | Species evidence |
| Salvia karwinskii | NepetoideaeSalvia | chloroplast | 1 | 2 | MT156372MT156372.1 | Species evidence |
| Salvia korolkovii | NepetoideaeSalvia | chloroplast | 1 | 2 | PV601298PV601298.1 | Species evidence |
| Salvia kronenburgii | NepetoideaeSalvia | chloroplast | 1 | 1 | PV870861PV870861.1 | Species evidence |
| Salvia leucantha | NepetoideaeSalvia | chloroplast | 1 | 2 | NC_084044NC_084044.1 | Species evidence |
| Salvia liguliloba | NepetoideaeSalvia | chloroplast | 1 | 2 | NC_067742NC_067742.1 | Species evidence |
| Salvia lilacinocoerulea | NepetoideaeSalvia | chloroplast | 1 | 2 | PV991053PV991053.1 | Species evidence |
| Salvia limbata | NepetoideaeSalvia | chloroplast | 1 | 1 | PV870862PV870862.1 | Species evidence |
| Salvia luteistriata | NepetoideaeSalvia | chloroplast | 1 | 2 | NC_067741NC_067741.1 | Species evidence |
| Salvia lyrata | NepetoideaeSalvia | chloroplast | 1 | 2 | NC_084048NC_084048.1 | Species evidence |
| Salvia madrensis | NepetoideaeSalvia | chloroplast | 1 | 2 | MT156373MT156373.1 | Species evidence |
| Salvia meiliensis | NepetoideaeSalvia | chloroplast | 1 | 1 | NC_050896NC_050896.1 | Species evidence |
| Salvia merjamie | NepetoideaeSalvia | chloroplast | 1 | 2 | NC_050897NC_050897.1 | Species evidence |
| Salvia microphylla | NepetoideaeSalvia | chloroplast | 1 | 2 | MT156365MT156365.1 | Species evidence |
| Salvia miltiorrhiza | NepetoideaeSalvia | chloroplast | 1 | 1 | NC_020431OR652279.1 | Species evidence |
| Salvia miltiorrhiza f. alba | NepetoideaeSalvia | chloroplast | 1 | 1 | MT012420MT012420.1 | Species evidence |
| Salvia mohavensis | NepetoideaeSalvia | chloroplast | 1 | 1 | PV870863PV870863.1 | Species evidence |
| Salvia multicaulis | NepetoideaeSalvia | chloroplast | 1 | 2 | OR684571OR684571.1 | Species evidence |
| Salvia munzii | NepetoideaeSalvia | chloroplast | 1 | 1 | PX971247PX971247.1 | Species evidence |
| Salvia nanchuanensis | NepetoideaeSalvia | chloroplast | 1 | 1 | NC_058851NC_058851.1 | Species evidence |
| Salvia nanchuanensis var. pteridifolia | NepetoideaeSalvia | chloroplast | 1 | 1 | MW435408MW435408.1 | Species evidence |
| Salvia nilotica | NepetoideaeSalvia | chloroplast | 1 | 2 | NC_050898NC_050898.1 | Species evidence |
| Salvia nipponica | NepetoideaeSalvia | chloroplast | 1 | 2 | MT156377MT156377.1 | Species evidence |
| Salvia nubicola | NepetoideaeSalvia | chloroplast | 1 | 2 | NC_067737NC_067737.1 | Species evidence |
| Salvia officinalis | NepetoideaeSalvia | chloroplast | 1 | 1 | NC_038165NC_038165.1 | Species evidence |
| Salvia officinalis subsp. gallica | NepetoideaeSalvia | chloroplast | 1 | 1 | PV870864PV870864.1 | Species evidence |
| Salvia omeiana | NepetoideaeSalvia | chloroplast | 1 | 1 | PX971248PX971248.1 | Species evidence |
| Salvia oxyphora | NepetoideaeSalvia | chloroplast | 1 | 2 | MT156374MT156374.1 | Species evidence |
| Salvia pachyphylla | NepetoideaeSalvia | chloroplast | 1 | 1 | PV870865PV870865.1 | Species evidence |
| Salvia petrophila | NepetoideaeSalvia | chloroplast | 1 | 1 | NC_050899NC_050899.1 | Species evidence |
| Salvia plebeia | NepetoideaeSalvia | chloroplast | 1 | 1 | NC_050929NC_050929.1 | Species evidence |
| Salvia plectranthoides | NepetoideaeSalvia | chloroplast | 1 | 1 | MW435409MW435409.1 | Species evidence |
| Salvia pratensis | NepetoideaeSalvia | chloroplast | 1 | 2 | PP272175PP272175.1 | Species evidence |
| Salvia prattii | NepetoideaeSalvia | chloroplast | 1 | 1 | MK944407MK944407.1 | Species evidence |
| Salvia prionitis | NepetoideaeSalvia | chloroplast | 1 | 1 | NC_065866NC_065866.1 | Species evidence |
| Salvia przewalskii | NepetoideaeSalvia | chloroplast | 1 | 2 | NC_041091NC_041091.1 | Species evidence |
| Salvia roborowskii | NepetoideaeSalvia | chloroplast | 1 | 2 | MW752206MW752206.1 | Species evidence |
| Salvia rosmarinus | NepetoideaeSalvia | chloroplast | 1 | 2 | NC_027259NC_027259.1 | Species evidence |
| Salvia saccardiana | NepetoideaeSalvia | chloroplast | 1 | 1 | PV870867PV870867.1 | Species evidence |
| Salvia scapiformis | NepetoideaeSalvia | chloroplast | 1 | 2 | NC_067743NC_067743.1 | Species evidence |
| Salvia sclarea | NepetoideaeSalvia | chloroplast | 1 | 1 | NC_050900NC_050900.1 | Species evidence |
| Salvia semiatrata | NepetoideaeSalvia | chloroplast | 1 | 2 | MT156370MT156370.1 | Species evidence |
| Salvia sikkimensis | NepetoideaeSalvia | chloroplast | 1 | 2 | NC_071851NC_071851.1 | Species evidence |
| Salvia sonchifolia | NepetoideaeSalvia | chloroplast | 1 | 2 | MW752201MW752201.1 | Species evidence |
| Salvia sonomensis | NepetoideaeSalvia | chloroplast | 1 | 1 | PV870868PV870868.1 | Species evidence |
| Salvia spathacea | NepetoideaeSalvia | chloroplast | 1 | 1 | PV870869PV870869.1 | Species evidence |
| Salvia splendens | NepetoideaeSalvia | chloroplast | 1 | 1 | NC_050901NC_050901.1 | Species evidence |
| Salvia subbipinnata | NepetoideaeSalvia | chloroplast | 1 | 1 | NC_063913NC_063913.1 | Species evidence |
| Salvia submutica | NepetoideaeSalvia | chloroplast | 1 | 2 | PV601299PV601299.1 | Species evidence |
| Salvia substolonifera | NepetoideaeSalvia | chloroplast | 1 | 1 | NC_061230NC_061230.1 | Species evidence |
| Salvia tianschanica | NepetoideaeSalvia | chloroplast | 1 | 2 | PV995245PV995245.1 | Species evidence |
| Salvia tiliifolia | NepetoideaeSalvia | chloroplast | 1 | 2 | NC_050053NC_050053.1 | Species evidence |
| Salvia tricuspis | NepetoideaeSalvia | chloroplast | 1 | 2 | NC_067738NC_067738.1 | Species evidence |
| Salvia trijuga | NepetoideaeSalvia | chloroplast | 1 | 1 | NC_061229NC_061229.1 | Species evidence |
| Salvia tubifera | NepetoideaeSalvia | chloroplast | 1 | 2 | MT156369MT156369.1 | Species evidence |
| Salvia tuerckheimii | NepetoideaeSalvia | chloroplast | 1 | 1 | PX971249PX971249.1 | Species evidence |
| Salvia umbratica | NepetoideaeSalvia | chloroplast | 1 | 2 | MW752208MW752208.1 | Species evidence |
| Salvia verbenaca | NepetoideaeSalvia | chloroplast | 1 | 2 | PP272176PP272176.1 | Species evidence |
| Salvia verticillata | NepetoideaeSalvia | chloroplast | 1 | 1 | PV340582PV340582.1 | Species evidence |
| Salvia verticillata subsp. verticillata | NepetoideaeSalvia | chloroplast | 1 | 2 | PP272177PP272177.1 | Species evidence |
| Salvia xanthocheila | NepetoideaeSalvia | chloroplast | 1 | 1 | PV870871PV870871.1 | Species evidence |
| Salvia yangii | NepetoideaeSalvia | chloroplast | 1 | 2 | NC_050902NC_050902.1 | Species evidence |
| Salvia yunnanensis | NepetoideaeSalvia | chloroplast | 1 | 1 | NC_050903NC_050903.1 | Species evidence |
| Satureja hortensis | NepetoideaeSatureja | chloroplast | 1 | 2 | PP316497PP316497.1 | Species evidence |
| Satureja khuzistanica | NepetoideaeSatureja | chloroplast | 1 | 1 | PV480542PV480542.1 | Species evidence |
| Satureja montana | NepetoideaeSatureja | chloroplast | 1 | 2 | NC_066034NC_066034.1 | Species evidence |
| Satureja montana subsp. variegata | NepetoideaeSatureja | chloroplast | 1 | 1 | PV480544PV480544.1 | Species evidence |
| Schizonepeta tenuifolia | NepetoideaeSchizonepeta | chloroplast | 1 | 2 | MW900176.1NC_061322 | Species evidence |
| Schnabelia aureoglandulosa | AjugoideaeSchnabelia | chloroplast | 1 | 2 | NC_088034NC_088034.1 | Species evidence |
| Schnabelia nepetifolia | AjugoideaeSchnabelia | chloroplast | 1 | 2 | NC_088035NC_088035.1 | Species evidence |
| Schnabelia oligophylla | AjugoideaeSchnabelia | chloroplast | 1 | 2 | NC_088036NC_088036.1 | Species evidence |
| Schnabelia terniflora | AjugoideaeSchnabelia | chloroplast | 1 | 2 | NC_065394NC_065394.1 | Species evidence |
| Schnabelia tetrodonta | AjugoideaeSchnabelia | chloroplast | 1 | 2 | NC_067499NC_067499.1 | Species evidence |
| Scutellaria adenostegia | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ058237PQ058237.1 | Species evidence |
| Scutellaria adsurgens | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ058240PQ058240.1 | Species evidence |
| Scutellaria agrestis | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ058275PQ058275.1 | Species evidence |
| Scutellaria albida | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059215PQ059215.1 | Species evidence |
| Scutellaria albida subsp. condensata | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW420937MW420937.1 | Species evidence |
| Scutellaria albida subsp. velenovskyi | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059241PQ059241.1 | Species evidence |
| Scutellaria alpina | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059196PQ059196.1 | Species evidence |
| Scutellaria altaica | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ075892PQ075892.1 | Species evidence |
| Scutellaria altamaha | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW420957MW420957.1 | Species evidence |
| Scutellaria altissima | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059199PQ059199.1 | Species evidence |
| Scutellaria amabilis | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ075894PQ075894.1 | Species evidence |
| Scutellaria amoena | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | NC_057255NC_057255.1 | Species evidence |
| Scutellaria angustifolia | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW420978MW420978.1 | Species evidence |
| Scutellaria antirrhinoides | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ075899PQ075899.1 | Species evidence |
| Scutellaria arabica | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059208PQ059208.1 | Species evidence |
| Scutellaria aurata | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ058277PQ058277.1 | Species evidence |
| Scutellaria austrotaiwanensis | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ075900PQ075900.1 | Species evidence |
| Scutellaria axilliflora | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ075901PQ075901.1 | Species evidence |
| Scutellaria axilliflora var. medullifera | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ075902PQ075902.1 | Species evidence |
| Scutellaria baicalensis | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | NC_027262NC_027262.1 | Species evidence |
| Scutellaria barbata | ScutellarioideaeScutellaria | chloroplast | 1 | 2 | NC_059814NC_059814.1 | Species evidence |
| Scutellaria bolanderi | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW420972MW420972.1 | Species evidence |
| Scutellaria brachyspica | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ075906PQ075906.1 | Species evidence |
| Scutellaria brevibracteata | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059216PQ059216.1 | Species evidence |
| Scutellaria brevibracteata subsp. subvelutina | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059224PQ059224.1 | Species evidence |
| Scutellaria calcarata | ScutellarioideaeScutellaria | chloroplast | 1 | 2 | MN128385MN128385.1 | Species evidence |
| Scutellaria californica | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ075909PQ075909.1 | Species evidence |
| Scutellaria caryopteroides | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | NC_072112NC_072112.1 | Species evidence |
| Scutellaria caudifolia | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ075911PQ075911.1 | Species evidence |
| Scutellaria caudifolia var. obliquifolia | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ075908PQ075908.1 | Species evidence |
| Scutellaria chungtienensis | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ075912PQ075912.1 | Species evidence |
| Scutellaria colpodea | ScutellarioideaeScutellaria | chloroplast | 1 | 2 | PZ130064PZ130064.1 | Species evidence |
| Scutellaria columnae | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059198PQ059198.1 | Species evidence |
| Scutellaria comosa | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ058241PQ058241.1 | Species evidence |
| Scutellaria cordifrons | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ058242PQ058242.1 | Species evidence |
| Scutellaria costaricana | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW420973MW420973.1 | Species evidence |
| Scutellaria cristata | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PZ130072PZ130072.1 | Species evidence |
| Scutellaria cypria | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | OR178745OR178745.1 | Species evidence |
| Scutellaria delavayi | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ075918PQ075918.1 | Species evidence |
| Scutellaria dependens | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW420952MW420952.1 | Species evidence |
| Scutellaria diffusa | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059212PQ059212.1 | Species evidence |
| Scutellaria discolor | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW420951MW420951.1 | Species evidence |
| Scutellaria drummondii | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW420974MW420974.1 | Species evidence |
| Scutellaria dumetorum | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059399PQ059399.1 | Species evidence |
| Scutellaria edelbergii | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059226PQ059226.1 | Species evidence |
| Scutellaria elliptica var. hirsuta | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059304PQ059304.1 | Species evidence |
| Scutellaria eplingii | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ058279PQ058279.1 | Species evidence |
| Scutellaria farsistanica | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059227PQ059227.1 | Species evidence |
| Scutellaria fedtschenkoi | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PZ130068PZ130068.1 | Species evidence |
| Scutellaria flocculosa | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ058280PQ058280.1 | Species evidence |
| Scutellaria forrestii | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | NC_072113NC_072113.1 | Species evidence |
| Scutellaria franchetiana | ScutellarioideaeScutellaria | chloroplast | 1 | 2 | NC_059813NC_059813.1 | Species evidence |
| Scutellaria galericulata | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059292PQ059292.1 | Species evidence |
| Scutellaria gardoquioides | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW413436MW413436.1 | Species evidence |
| Scutellaria gaumeri | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW420958MW420958.1 | Species evidence |
| Scutellaria glabrata | ScutellarioideaeScutellaria | chloroplast | 1 | 2 | PZ130067PZ130067.1 | Species evidence |
| Scutellaria glutinosa | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059222PQ059222.1 | Species evidence |
| Scutellaria grandiflora | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ058243PQ058243.1 | Species evidence |
| Scutellaria grossa | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059197PQ059197.1 | Species evidence |
| Scutellaria grossheimiana | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059204PQ059204.1 | Species evidence |
| Scutellaria guatemalensis | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW420965MW420965.1 | Species evidence |
| Scutellaria guttata | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ058239PQ058239.1 | Species evidence |
| Scutellaria hainanensis | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ075885PQ075885.1 | Species evidence |
| Scutellaria hastifolia | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW420934MW420934.1 | Species evidence |
| Scutellaria helenae | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059306PQ059306.1 | Species evidence |
| Scutellaria heterophylla | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW420938MW420938.1 | Species evidence |
| Scutellaria heydei | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW420941MW420941.1 | Species evidence |
| Scutellaria hintoniana | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW420959MW420959.1 | Species evidence |
| Scutellaria hissarica | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW420942MW420942.1 | Species evidence |
| Scutellaria holosericea | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PZ130066PZ130066.1 | Species evidence |
| Scutellaria humilis | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ058251PQ058251.1 | Species evidence |
| Scutellaria hypericifolia | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW286270MW286270.1 | Species evidence |
| Scutellaria immaculata | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW420944MW420944.1 | Species evidence |
| Scutellaria incana | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW420975MW420975.1 | Species evidence |
| Scutellaria indica | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | NC_072111NC_072111.1 | Species evidence |
| Scutellaria indica var. coccinea | ScutellarioideaeScutellaria | chloroplast | 1 | 2 | MN047312MN047312.1 | Species evidence |
| Scutellaria indica var. elliptica | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059294PQ059294.1 | Species evidence |
| Scutellaria indica var. parvifolia | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059312PQ059312.1 | Species evidence |
| Scutellaria indica var. subacaulis | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059311PQ059311.1 | Species evidence |
| Scutellaria insignis | ScutellarioideaeScutellaria | chloroplast | 1 | 2 | NC_028533NC_028533.1 | Species evidence |
| Scutellaria integrifolia | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059295PQ059295.1 | Species evidence |
| Scutellaria intermedia | ScutellarioideaeScutellaria | chloroplast | 1 | 2 | PZ130070PZ130070.1 | Species evidence |
| Scutellaria isocheila | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ058270PQ058270.1 | Species evidence |
| Scutellaria javanica | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059314PQ059314.1 | Species evidence |
| Scutellaria javanica var. luzonica | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ058285PQ058285.1 | Species evidence |
| Scutellaria karjaginii | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059195PQ059195.1 | Species evidence |
| Scutellaria kingiana | ScutellarioideaeScutellaria | chloroplast | 1 | 2 | MN128389MN128389.1 | Species evidence |
| Scutellaria kotkaiensis | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059229PQ059229.1 | Species evidence |
| Scutellaria kuramensis | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PZ130062PZ130062.1 | Species evidence |
| Scutellaria laeteviolacea | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ075890PQ075890.1 | Species evidence |
| Scutellaria laeteviolacea var. maekawae | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059359PQ059359.1 | Species evidence |
| Scutellaria lanipes | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ058244PQ058244.1 | Species evidence |
| Scutellaria lateriflora | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ058260PQ058260.1 | Species evidence |
| Scutellaria laxa | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059296PQ059296.1 | Species evidence |
| Scutellaria leptosiphon | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW420940MW420940.1 | Species evidence |
| Scutellaria likiangensis | ScutellarioideaeScutellaria | chloroplast | 1 | 2 | NC_061416NC_061416.1 | Species evidence |
| Scutellaria linarioides | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059316PQ059316.1 | Species evidence |
| Scutellaria linearis | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW420945MW420945.1 | Species evidence |
| Scutellaria litwinowii | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059317PQ059317.1 | Species evidence |
| Scutellaria longifolia | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW420966MW420966.1 | Species evidence |
| Scutellaria macrosiphon | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059318PQ059318.1 | Species evidence |
| Scutellaria meehanioides | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | NC_057189NC_057189.1 | Species evidence |
| Scutellaria megalaspis | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059231PQ059231.1 | Species evidence |
| Scutellaria mesostegia | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ075922PQ075922.1 | Species evidence |
| Scutellaria mexicana | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW420976MW420976.1 | Species evidence |
| Scutellaria microdasys | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059319PQ059319.1 | Species evidence |
| Scutellaria microviolacea | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059320PQ059320.1 | Species evidence |
| Scutellaria minor | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059360PQ059360.1 | Species evidence |
| Scutellaria mollifolia | ScutellarioideaeScutellaria | chloroplast | 1 | 2 | MN128384MN128384.1 | Species evidence |
| Scutellaria mollis | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW420947MW420947.1 | Species evidence |
| Scutellaria moniliorhiza | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW420954MW420954.1 | Species evidence |
| Scutellaria multicaulis | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW420936MW420936.1 | Species evidence |
| Scutellaria muramatsui | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059322PQ059322.1 | Species evidence |
| Scutellaria nana | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW420969MW420969.1 | Species evidence |
| Scutellaria nervosa | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ058257PQ058257.1 | Species evidence |
| Scutellaria nummulariifolia | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW420960MW420960.1 | Species evidence |
| Scutellaria nuristanica | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059232PQ059232.1 | Species evidence |
| Scutellaria oligodonta | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059335PQ059335.1 | Species evidence |
| Scutellaria omeiensis var. serratifolia | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059324PQ059324.1 | Species evidence |
| Scutellaria orientalis | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW420933MW420933.1 | Species evidence |
| Scutellaria orientalis subsp. bornmuelleri | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059223PQ059223.1 | Species evidence |
| Scutellaria orientalis subsp. orientalis | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059343PQ059343.1 | Species evidence |
| Scutellaria orthocalyx | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW420955MW420955.1 | Species evidence |
| Scutellaria ossethica | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059233PQ059233.1 | Species evidence |
| Scutellaria ovata | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW420970MW420970.1 | Species evidence |
| Scutellaria ovata subsp. ovata | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059328PQ059328.1 | Species evidence |
| Scutellaria pacifica | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059298PQ059298.1 | Species evidence |
| Scutellaria parvula | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW420964MW420964.1 | Species evidence |
| Scutellaria parvula var. australis | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059330PQ059330.1 | Species evidence |
| Scutellaria parvula var. leonardi | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059313PQ059313.1 | Species evidence |
| Scutellaria paulsenii | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ058238PQ058238.1 | Species evidence |
| Scutellaria pekinensis var. maxima | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW420953MW420953.1 | Species evidence |
| Scutellaria pekinensis var. pekinensis | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059333PQ059333.1 | Species evidence |
| Scutellaria pekinensis var. purpureicaulis | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059331PQ059331.1 | Species evidence |
| Scutellaria pekinensis var. transitra | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059299PQ059299.1 | Species evidence |
| Scutellaria pekinensis var. ussuriensis | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059194PQ059194.1 | Species evidence |
| Scutellaria peregrina | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059200PQ059200.1 | Species evidence |
| Scutellaria petiolata | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059234PQ059234.1 | Species evidence |
| Scutellaria phyllostachya | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PZ130071PZ130071.1 | Species evidence |
| Scutellaria pinnatifida | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059326PQ059326.1 | Species evidence |
| Scutellaria pinnatifida subsp. alpina | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059206PQ059206.1 | Species evidence |
| Scutellaria pinnatifida subsp. mucida | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW420948MW420948.1 | Species evidence |
| Scutellaria pinnatifida subsp. pichleri | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW420935MW420935.1 | Species evidence |
| Scutellaria platensis | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW420949MW420949.1 | Species evidence |
| Scutellaria platystegia | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059235PQ059235.1 | Species evidence |
| Scutellaria polyadenia | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ058256PQ058256.1 | Species evidence |
| Scutellaria pontica | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059211PQ059211.1 | Species evidence |
| Scutellaria porphyrantha | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059236PQ059236.1 | Species evidence |
| Scutellaria prostrata | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059300PQ059300.1 | Species evidence |
| Scutellaria przewalskii | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059325PQ059325.1 | Species evidence |
| Scutellaria purpurascens | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ058276PQ058276.1 | Species evidence |
| Scutellaria purpurascens subsp. purpurascens | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ058269PQ058269.1 | Species evidence |
| Scutellaria pycnoclada | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PZ130060PZ130060.1 | Species evidence |
| Scutellaria quadrilobulata | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059301PQ059301.1 | Species evidence |
| Scutellaria racemosa | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059336PQ059336.1 | Species evidence |
| Scutellaria raddeana | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059237PQ059237.1 | Species evidence |
| Scutellaria ramosissima | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059244PQ059244.1 | Species evidence |
| Scutellaria rehderiana | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MT982397MT982397.1 | Species evidence |
| Scutellaria resinosa | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ058263PQ058263.1 | Species evidence |
| Scutellaria rubicunda | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW420939MW420939.1 | Species evidence |
| Scutellaria rubropunctata | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059337PQ059337.1 | Species evidence |
| Scutellaria salviifolia | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059210PQ059210.1 | Species evidence |
| Scutellaria scandens | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059338PQ059338.1 | Species evidence |
| Scutellaria schachristanica | ScutellarioideaeScutellaria | chloroplast | 1 | 2 | PZ130063PZ130063.1 | Species evidence |
| Scutellaria schweinfurthii | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ058254PQ058254.1 | Species evidence |
| Scutellaria schweinfurthii subsp. paucifolia | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ058255PQ058255.1 | Species evidence |
| Scutellaria scordifolia | ScutellarioideaeScutellaria | chloroplast | 1 | 2 | NC_052883NC_052883.1 | Species evidence |
| Scutellaria scordiifolia var. ammophila | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059339PQ059339.1 | Species evidence |
| Scutellaria scordiifolia var. puberula | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059189PQ059189.1 | Species evidence |
| Scutellaria scutellarioides | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW420961MW420961.1 | Species evidence |
| Scutellaria seleriana | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW420962MW420962.1 | Species evidence |
| Scutellaria serrata | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059340PQ059340.1 | Species evidence |
| Scutellaria sessilifolia | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059344PQ059344.1 | Species evidence |
| Scutellaria shikokiana | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059190PQ059190.1 | Species evidence |
| Scutellaria sibthorpii | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059217PQ059217.1 | Species evidence |
| Scutellaria sieberi | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059342PQ059342.1 | Species evidence |
| Scutellaria sieversii | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059345PQ059345.1 | Species evidence |
| Scutellaria siphocampyloides | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW420977MW420977.1 | Species evidence |
| Scutellaria sosnowskyi | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ075921PQ075921.1 | Species evidence |
| Scutellaria sp | ScutellarioideaeScutellaria | chloroplast | 0 | 1 | PQ058272.1 | Species evidence |
| Scutellaria splendens | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW420963MW420963.1 | Species evidence |
| Scutellaria stocksii | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059230PQ059230.1 | Species evidence |
| Scutellaria striatella | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PZ130065PZ130065.1 | Species evidence |
| Scutellaria strigillosa | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW420956MW420956.1 | Species evidence |
| Scutellaria subcaespitosa | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ058249PQ058249.1 | Species evidence |
| Scutellaria suffrutescens | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW420967MW420967.1 | Species evidence |
| Scutellaria supina | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PZ130069PZ130069.1 | Species evidence |
| Scutellaria tashiroi | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059348PQ059348.1 | Species evidence |
| Scutellaria tayloriana | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059349PQ059349.1 | Species evidence |
| Scutellaria tenera | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059191PQ059191.1 | Species evidence |
| Scutellaria teucriifolia | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059238PQ059238.1 | Species evidence |
| Scutellaria theobromina | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059239PQ059239.1 | Species evidence |
| Scutellaria tienchuanensis | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059351PQ059351.1 | Species evidence |
| Scutellaria tomentosa | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW420943MW420943.1 | Species evidence |
| Scutellaria tournefortii | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059214PQ059214.1 | Species evidence |
| Scutellaria tsinyunensis | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | NC_050161NC_050161.1 | Species evidence |
| Scutellaria tuberifera | ScutellarioideaeScutellaria | chloroplast | 1 | 2 | NC_059812NC_059812.1 | Species evidence |
| Scutellaria tuberosa | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059352PQ059352.1 | Species evidence |
| Scutellaria tuminensis | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059353PQ059353.1 | Species evidence |
| Scutellaria tuvensis | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059303PQ059303.1 | Species evidence |
| Scutellaria uliginosa | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ058274PQ058274.1 | Species evidence |
| Scutellaria urticifolia | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PZ130059PZ130059.1 | Species evidence |
| Scutellaria utriculata | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059221PQ059221.1 | Species evidence |
| Scutellaria velutina | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ058248PQ058248.1 | Species evidence |
| Scutellaria ventenatii | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ058273PQ058273.1 | Species evidence |
| Scutellaria veronicifolia var. patentipilosa | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059350PQ059350.1 | Species evidence |
| Scutellaria villosissima | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PZ130061PZ130061.1 | Species evidence |
| Scutellaria violacea | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ058250PQ058250.1 | Species evidence |
| Scutellaria violacea var. violacea | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ075913PQ075913.1 | Species evidence |
| Scutellaria violascens | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ058253PQ058253.1 | Species evidence |
| Scutellaria viscidula | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | MW286272MW286272.1 | Species evidence |
| Scutellaria woodii | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ058281PQ058281.1 | Species evidence |
| Scutellaria wrightii | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ058264PQ058264.1 | Species evidence |
| Scutellaria wulingshanensis | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059355PQ059355.1 | Species evidence |
| Scutellaria x churchilliana | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ058261PQ058261.1 | Species evidence |
| Scutellaria yezoensis | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059346PQ059346.1 | Species evidence |
| Scutellaria yingtakensis | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059356PQ059356.1 | Species evidence |
| Scutellaria yunnanensis var. salicifolia | ScutellarioideaeScutellaria | chloroplast | 1 | 1 | PQ059357PQ059357.1 | Species evidence |
| Stachys affinis | LamioideaeStachys | chloroplast | 1 | 2 | NC_062803NC_062803.1 | Species evidence |
| Stachys byzantina | LamioideaeStachys | chloroplast | 1 | 2 | NC_029825NC_029825.1 | Species evidence |
| Stachys chamissonis | LamioideaeStachys | chloroplast | 1 | 2 | NC_029822NC_029822.1 | Species evidence |
| Stachys coccinea | LamioideaeStachys | chloroplast | 1 | 2 | NC_029823NC_029823.1 | Species evidence |
| Stachys geobombycis | LamioideaeStachys | chloroplast | 1 | 1 | NC_082543NC_082543.1 | Species evidence |
| Stachys germanica | LamioideaeStachys | chloroplast | 1 | 1 | PX260186PX260186.1 | Species evidence |
| Stachys japonica | LamioideaeStachys | chloroplast | 1 | 1 | MT554703MT554703.1 | Species evidence |
| Stachys persica | LamioideaeStachys | chloroplast | 1 | 1 | PX260185PX260185.1 | Species evidence |
| Stachys recta subsp. labiosa | LamioideaeStachys | chloroplast | 1 | 2 | PP272178PP272178.1 | Species evidence |
| Stachys recta subsp. recta | LamioideaeStachys | chloroplast | 1 | 2 | PP272180PP272180.1 | Species evidence |
| Stachys sylvatica | LamioideaeStachys | chloroplast | 1 | 2 | NC_029824NC_029824.1 | Species evidence |
| Stenogyne bifida | LamioideaeStenogyne | chloroplast | 1 | 2 | NC_029818NC_029818.1 | Species evidence |
| Tectona grandis | TectonoideaeTectona | chloroplast | 1 | 2 | NC_020098NC_020098.1 | Species evidence |
| Teucrium chamaedrys | AjugoideaeTeucrium | chloroplast | 1 | 1 | PV340612PV340612.1 | Species evidence |
| Teucrium chamaedrys subsp. chamaedrys | AjugoideaeTeucrium | chloroplast | 1 | 2 | PP272183PP272183.1 | Species evidence |
| Teucrium flavum | AjugoideaeTeucrium | chloroplast | 1 | 1 | PV340613PV340613.1 | Species evidence |
| Teucrium fruticans | AjugoideaeTeucrium | chloroplast | 1 | 1 | NC_061173NC_061173.1 | Species evidence |
| Teucrium montanum | AjugoideaeTeucrium | chloroplast | 1 | 2 | PP272184PP272184.1 | Species evidence |
| Teucrium omeiense | AjugoideaeTeucrium | chloroplast | 1 | 2 | MN814871MN814871.1 | Species evidence |
| Teucrium ornatum | AjugoideaeTeucrium | chloroplast | 1 | 2 | MN814864MN814864.1 | Species evidence |
| Teucrium polium | AjugoideaeTeucrium | chloroplast | 1 | 1 | PV340614PV340614.1 | Species evidence |
| Teucrium simplex | AjugoideaeTeucrium | chloroplast | 1 | 1 | MN814872MN814872.1 | Species evidence |
| Teucrium stocksianum subsp. stocksianum | AjugoideaeTeucrium | chloroplast | 1 | 2 | MH325133MH325133.1 | Species evidence |
| Thymbra capitata | NepetoideaeThymbra | chloroplast | 1 | 2 | NC_086488NC_086488.1 | Species evidence |
| Thymus japonicus | NepetoideaeThymus | chloroplast | 1 | 1 | NC_046822NC_046822.1 | Species evidence |
| Thymus linearis | NepetoideaeThymus | chloroplast | 1 | 2 | NC_071852NC_071852.1 | Species evidence |
| Thymus mastichina | NepetoideaeThymus | chloroplast | 1 | 2 | NC_086485NC_086485.1 | Species evidence |
| Thymus mongolicus | NepetoideaeThymus | chloroplast | 1 | 2 | NC_046520NC_046520.1 | Species evidence |
| Thymus praecox subsp. polytrichus | NepetoideaeThymus | chloroplast | 1 | 2 | PP272181PP272181.1 | Species evidence |
| Thymus praecox subsp. praecox | NepetoideaeThymus | chloroplast | 1 | 2 | PP272182PP272182.1 | Species evidence |
| Thymus quinquecostatus | NepetoideaeThymus | chloroplast | 1 | 2 | NC_069224NC_069224.1 | Species evidence |
| Thymus subnervosus | NepetoideaeThymus | chloroplast | 1 | 2 | PZ130073PZ130073.1 | Species evidence |
| Thymus villosus subsp. lusitanicus | NepetoideaeThymus | chloroplast | 1 | 2 | ON641262ON641262.1 | Species evidence |
| Thymus vulgaris | NepetoideaeThymus | chloroplast | 1 | 2 | NC_086487NC_086487.1 | Species evidence |
| Tinnea aethiopica | ScutellarioideaeTinnea | chloroplast | 1 | 1 | MW420971MW420971.1 | Species evidence |
| Vitex agnus-castus | ViticoideaeVitex | chloroplast | 1 | 2 | NC_088534NC_088534.1 | Species evidence |
| Vitex bicolor | ViticoideaeVitex | chloroplast | 1 | 2 | NC_065871NC_065871.1 | Species evidence |
| Vitex negundo | ViticoideaeVitex | chloroplast | 1 | 2 | NC_057235NC_057235.1 | Species evidence |
| Vitex negundo var. cannabifolia | ViticoideaeVitex | chloroplast | 1 | 1 | PQ541021PQ541021.1 | Species evidence |
| Vitex parviflora | ViticoideaeVitex | chloroplast | 1 | 1 | NC_065666NC_065666.1 | Species evidence |
| Vitex rotundifolia | ViticoideaeVitex | chloroplast | 1 | 2 | NC_050991NC_050991.1 | Species evidence |
| Vitex trifolia | ViticoideaeVitex | chloroplast | 1 | 2 | NC_062602NC_062602.1 | Species evidence |
| Volkameria inermis | AjugoideaeVolkameria | chloroplast | 1 | 1 | PQ463296PQ463296.1 | Species evidence |
| Wenchengia alternifolia | ScutellarioideaeWenchengia | chloroplast | 1 | 2 | NC_064367NC_064367.1 | Species evidence |
| Ziziphora capitata | NepetoideaeZiziphora | chloroplast | 1 | 1 | PV226239PV226239.1 | Species evidence |
| Ziziphora clinopodioides | NepetoideaeZiziphora | chloroplast | 1 | 1 | PV116304PV116304.1 | Species evidence |
| Ziziphora pamiroalaica | NepetoideaeZiziphora | chloroplast | 1 | 1 | PV138186PV138186.1 | Species evidence |
| Ziziphora pedicellata | NepetoideaeZiziphora | chloroplast | 1 | 1 | PV138187PV138187.1 | Species evidence |
Raw accession, coordinate range, strand and feature type remain visible. Duplicate copies within an assembly are not collapsed.
Showing the first 80 coordinate records of 1121. Use species and accession filters to narrow the evidence.
Only nucleotide records are publicly exposed. Protein sequences are intentionally omitted.
MN814854ATGATTTTTCAATCTTTTCTACTAGGTAATCTAGTATCCTTATGCATGAAGATAATCAATTCGGTCGTTGTGGTCGGACTCTATTATGGA…
PZ101788ATGTCATTTCTAGTCTATCTCTTTCTATTTCTTTTCTATATATGGAAAGTTCAAAAATCATCATATAATAATCCAGAAATTGCAATAGAA…
PZ101794ATGTCATTTCTAGTCTATCTCTTTCTATTTCTTTTCTATATATGGAAAGTTCAAAAATCATCATATAATAATCCAGAAATTGCAATAGAA…
NC_061322ATGATTTTTCAATCTTTTCTACTAGGTAATCTAGTATCCTTATGCATGAAGCTAATCAATTCGGTCGTTGTGGTCGGACTCTATTATGGA…
NC_027262ATGATTTTTCAATCTTTTCTACTAGGTAATCTAGTATCCTTATGCATGAAGATAATTAATTCGGTCGTTGTGGTCGGACTCTATTATGGA…
NC_020431ATGATTTTTCAATCTTTTCTACTAGGTAATCTAGTATCCTTATGCATGAAGCTAATCAATTCGGTCGTTGTGGTCGGACTCTATTATGGA…
NC_030755ATGATTTTTCAATCTTTTCTACTAGGTAATCTAGTATCCTTATGCATGAAGATAATCAATTCGGTCGTTGTGGTCGGACTCTATTATGGA…
NC_035143GTGATGATTTTTCAATCTTTTCTACTAGGTAATCTAGTATCCTTATGCATGAAGATAATCAATTCGGTCATTGTGGTCGGACTCTATTAT…
NC_027259ATGATTTTTCAATCTTTTCTACTAGGTAATCTAGTATCCTTATGCATGAAGCTAATCAATTCGGTCGTTGTGGTCGGACTCTATTATGGA…
NC_053706ATGATTTTTCAATCTTTTCTACTAGGTAATCTAGTATCCTTATGCATGAAGCTAATCAATTCGGTCGTTGTGGTCGGACTCTATTATGGA…
NC_068635ATGATTTTTCAATCTTTTCTACTAGGTAATCTAGTATCCTTATGCATGAAGATAATCAATTCGGTCGTTGTGGTCGGACTCTATTATGGA…
NC_084165ATGATTTTTCAATCTTTTCTACTAGGTAATCTAGTATCCTTATGCATGAAGATAATCAATTCGGTCGTTGTGGTCGGACTCTATTATGGA…
MN814852ATGATTTTTCAATCTTTTCTACTAGGTAATCTAGTATCCTTATGCATGAAGATAATCAATTCGGTCGTTGTGGTCGGACTCTATTATGGA…
MN814853ATGATTTTTCAATCTTTTCTACTAGGTAATCTAGTATCCTTATGCATGAAGATAATCAATTCGGTCGTTGTGGTCGGACTCTATTATGGA…
NC_048512ATGATTTTTCAATCTTTTCTACTAGGTAATCTAGTATCCTTATGCATGAAGATAATCAATTCGGTCGTTGTGGTCGGACTCTATTATGGA…
PP024532ATGTCGTTTCTAGTCTACCTCTTTCTATTTCTTTTCTATATATGGAAAGTTCAAAAATCATCATATAATAATCCAGAAATTGCAATAGAA…
PV243805ATGATTTTTCAATCTTTTCTACTAGGTAATCTAGTATCCTTATGCATGAAGATAATCAATTCGGTCGTTGTGGTCGGACTCTATTATGGA…
NC_084166ATGATTTTTCAATCTTTTCTACTAGGTAATCTAGTATCCTTATGCATGAAGATAATCAATTCGGTCGTTGTGGTCGGACTCTATTATGGA…
PQ178989ATGATTTTTCAATCTTTTCTACTAGGTAATCTAGTATCCTTATGCATGAAGATAATCAATTCGGTCGTTGTGGTCGGACTCTATTATGGA…
NC_084167ATGATTTTTCAATCTTTTCTACTAGGTAATCTAGTATCCTTATGCATGAAGATAATCAATTCGGTCGTTGTGGTCGGACTCTATTATGGA…
NC_071844ATGATTTTTCAATCTTTTCTACTAGGTAATCTAGTATCCTTATGCATGAAGATAATCAATTCGGTCGTTGTGGTCGGACTCTATTATGGA…
NC_084168ATGCGATCTCAAAGGCGTAAAATATTTATTTTCGAATTGTTTCAAGCAAATGTGCATTCCCCCCTTTTTTTGGAAAGACTACAAAAAAGG…
PP024533ATGTCGTTTCTAGTCTACCTCTTTCTATTTCTTTTCTATATATGGAAAGTTCAAAAATCATCATATAATAATCCAGAAATTGCAATAGAA…
PP024534ATGTCGTTTCTAGTCTACCTCTTTCTATTTCTTTTCTATATATGGAAAGTTCAAAAATCATCATATAATAATCCAGAAATTGCAATAGAA…
Traceable identifiers associated with this gene evidence.
OR699050.13 linked recordsNC_084413.13 linked recordsNC_084414.13 linked recordsNC_084412.13 linked recordsNC_053706.12 linked recordsNC_068635.12 linked recordsNC_084165.12 linked recordsMN814852.12 linked recordsMN814853.12 linked recordsMN814854.12 linked recordsPP024532.12 linked recordsPV243805.12 linked recordsNC_084166.12 linked recordsPQ178989.12 linked recordsNC_084167.12 linked recordsNC_071844.12 linked recordsNC_084168.12 linked recordsPP024533.12 linked recordsPP024534.12 linked recordsPV192927.12 linked recordsNC_066022.12 linked recordsPP840338.12 linked recordsPP103299.12 linked recordsNC_058322.12 linked recordsLC775283.12 linked recordsNC_052748.12 linked recordsNC_084175.12 linked recordsNC_058323.12 linked recordsNC_058324.12 linked recordsNC_035729.12 linked recordsNC_069833.12 linked recordsMN814860.12 linked recordsNC_058326.12 linked recordsNC_056393.12 linked recordsNC_068774.12 linked recordsNC_084176.12 linked recordsNC_056260.12 linked recordsNC_056199.12 linked recordsMN814861.12 linked recordsNC_073114.12 linked recordsNC_057680.12 linked recordsMN814862.12 linked recordsNC_058327.12 linked recordsPP190943.12 linked recordsPP024531.12 linked recordsON641271.12 linked recordsPP190944.12 linked recordsPX923121.12 linked recordsNC_058329.12 linked recordsPQ634728.12 linked recordsNC_058330.12 linked recordsNC_058331.12 linked recordsNC_058332.12 linked recordsNC_058334.12 linked recordsNC_058335.12 linked recordsNC_079586.12 linked recordsNC_068133.12 linked recordsPX928789.12 linked recordsNC_062584.12 linked recordsNC_066037.12 linked recordsNC_031874.12 linked recordsNC_061214.12 linked recordsNC_068682.12 linked recordsPX929666.12 linked recordsNC_058336.12 linked recordsNC_057508.12 linked recordsNC_067948.12 linked recordsOR701859.12 linked recordsNC_067947.12 linked recordsNC_071845.12 linked recordsNC_068005.12 linked recordsNC_071846.12 linked recordsPP190947.12 linked recordsPP190948.12 linked recordsPP203124.12 linked recordsPP203125.12 linked recordsPP203126.12 linked recordsMK609928.12 linked recordsNC_053620.12 linked recordsNC_029819.12 linked recordsNC_047486.12 linked recordsPP165049.12 linked recordsNC_067642.12 linked recordsNC_067643.12 linked recordsNC_067644.12 linked recordsNC_067645.12 linked recordsNC_067647.12 linked recordsNC_067648.12 linked recordsNC_067649.12 linked recordsNC_067670.12 linked recordsNC_067650.12 linked recordsNC_067651.12 linked recordsNC_067652.12 linked recordsNC_067706.12 linked recordsNC_067646.12 linked recordsON858844.12 linked recordsON858843.12 linked recordsNC_067653.12 linked recordsNC_067654.12 linked recordsNC_067655.12 linked recordsNC_067694.12 linked recordsNC_067656.12 linked recordsNC_067779.12 linked recordsNC_067657.12 linked recordsNC_067780.12 linked recordsNC_067696.12 linked recordsNC_067658.12 linked recordsNC_067701.12 linked recordsNC_067659.12 linked recordsNC_067660.12 linked recordsON858856.12 linked recordsON858868.12 linked recordsNC_067661.12 linked recordsON858858.12 linked recordsNC_067781.12 linked recordsNC_067662.12 linked recordsNC_067663.12 linked recordsNC_067782.12 linked recordsON858864.12 linked recordsON858903.12 linked recordsNC_067664.12 linked recordsNC_067665.12 linked recordsNC_067695.12 linked recordsNC_067783.12 linked recordsON858870.12 linked recordsNC_067667.12 linked recordsNC_067668.12 linked recordsNC_067666.12 linked recordsNC_067669.12 linked recordsNC_067705.12 linked recordsNC_067671.12 linked recordsNC_067704.12 linked recordsNC_067700.12 linked recordsNC_058575.12 linked recordsNC_067672.12 linked recordsNC_067673.12 linked recordsNC_067674.12 linked recordsNC_067675.12 linked recordsNC_067707.12 linked recordsNC_067677.12 linked recordsNC_067678.12 linked recordsNC_067697.12 linked recordsNC_067698.12 linked recordsNC_067709.12 linked recordsNC_067699.12 linked recordsNC_053708.12 linked recordsNC_067679.12 linked recordsNC_067680.12 linked recordsNC_067708.12 linked recordsNC_067681.12 linked recordsNC_067682.12 linked recordsNC_067683.12 linked recordsNC_067703.12 linked recordsNC_067702.12 linked recordsON858908.12 linked recordsNC_067684.12 linked recordsMW940491.12 linked recordsNC_067685.12 linked recordsNC_067686.12 linked recordsNC_067693.12 linked recordsON858906.12 linked recordsNC_067687.12 linked recordsNC_067688.12 linked recordsNC_067689.12 linked recordsNC_067690.12 linked recordsNC_067692.12 linked recordsNC_067691.12 linked recordsNC_067785.12 linked recordsPV192925.12 linked recordsPQ126530.12 linked recordsPQ126531.12 linked recordsPP203135.12 linked recordsPP203136.12 linked recordsPP336767.12 linked recordsMN240520.12 linked recordsON641259.12 linked recordsON641264.12 linked recordsNC_086629.12 linked recordsNC_058592.12 linked recordsNC_038062.12 linked recordsNC_084051.12 linked recordsPV558881.12 linked recordsMT980792.12 linked recordsNC_071847.12 linked recordsNC_066033.12 linked recordsPP165060.12 linked recordsNC_044082.12 linked recordsNC_032054.12 linked recordsNC_086489.12 linked recordsNC_037247.12 linked recordsNC_086486.12 linked recordsNC_047475.12 linked recordsNC_063687.12 linked recordsNC_071848.12 linked recordsNC_058882.12 linked recordsNC_071849.12 linked recordsPV837617.12 linked recordsNC_057283.12 linked recordsNC_071850.12 linked recordsNC_079695.12 linked recordsPZ530182.12 linked recordsOQ706275.12 linked recordsOR478166.12 linked recordsNC_057196.12 linked recordsMW829603.22 linked recordsNC_043873.12 linked recordsNC_082140.12 linked recordsPQ468695.12 linked recordsON641292.12 linked recordsON641323.12 linked recordsNC_067787.12 linked recordsNC_058605.12 linked recordsKT220686.12 linked recordsKT220685.12 linked recordsKT220688.12 linked recordsKT220689.12 linked recordsNC_030757.12 linked recordsNC_065868.12 linked recordsMN814865.12 linked recordsPV929680.12 linked recordsOP186467.12 linked recordsNC_061415.12 linked recordsPX921649.12 linked recordsNC_067634.12 linked recordsNC_065733.12 linked recordsNC_070070.12 linked recordsNC_061394.12 linked recordsNC_029820.12 linked recordsNC_085368.12 linked recordsMT328397.12 linked recordsNC_066019.12 linked recordsNC_031434.12 linked recordsNC_031433.12 linked recordsNC_026291.12 linked recordsNC_039654.12 linked recordsPP272174.12 linked recordsMN814866.12 linked recordsMT740257.12 linked recordsNC_059906.12 linked recordsMN814867.12 linked recordsMT156363.12 linked recordsNC_067739.12 linked recordsNC_084049.12 linked recordsMT156371.12 linked recordsPV601297.12 linked recordsNC_041092.12 linked recordsNC_057284.12 linked recordsNC_067740.12 linked recordsMW387501.12 linked recordsNC_040121.12 linked recordsMT156364.12 linked recordsNC_059718.12 linked recordsNC_084045.12 linked recordsNC_050895.12 linked recordsNC_084050.12 linked recordsNC_084047.12 linked recordsNC_067735.12 linked recordsNC_067736.12 linked recordsNC_084046.12 linked recordsPV972776.12 linked recordsMT156366.12 linked recordsMT156372.12 linked recordsPV601298.12 linked recordsNC_084044.12 linked recordsNC_067742.12 linked recordsPV991053.12 linked recordsNC_067741.12 linked recordsNC_084048.12 linked recordsMT156373.12 linked recordsNC_050897.12 linked recordsMT156365.12 linked recordsOR684571.12 linked recordsNC_050898.12 linked recordsMT156377.12 linked recordsNC_067737.12 linked recordsMT156374.12 linked recordsPP272175.12 linked recordsNC_041091.12 linked recordsMW752206.12 linked recordsNC_027259.12 linked recordsNC_067743.12 linked recordsMT156370.12 linked recordsNC_071851.12 linked recordsMW752201.12 linked recordsPV601299.12 linked recordsPV995245.12 linked recordsNC_050053.12 linked recordsNC_067738.12 linked recordsMT156369.12 linked recordsMW752208.12 linked recordsPP272176.12 linked recordsPP272177.12 linked recordsNC_050902.12 linked recordsPP316497.12 linked recordsNC_066034.12 linked recordsMW900176.12 linked recordsNC_088034.12 linked recordsNC_088035.12 linked recordsNC_088036.12 linked recordsNC_065394.12 linked recordsNC_067499.12 linked recordsNC_059814.12 linked recordsMN128385.12 linked recordsPZ130064.12 linked recordsNC_059813.12 linked recordsPZ130067.12 linked recordsMN047312.12 linked recordsNC_028533.12 linked recordsPZ130070.12 linked recordsMN128389.12 linked recordsNC_061416.12 linked recordsMN128384.12 linked recordsPZ130063.12 linked recordsNC_052883.12 linked recordsNC_059812.12 linked recordsNC_062803.12 linked recordsNC_029825.12 linked recordsNC_029822.12 linked recordsNC_029823.12 linked recordsPP272178.12 linked recordsPP272180.12 linked recordsNC_029824.12 linked recordsNC_029818.12 linked recordsNC_020098.12 linked recordsPP272183.12 linked recordsPP272184.12 linked recordsMN814871.12 linked recordsMN814864.12 linked recordsMH325133.12 linked recordsNC_086488.12 linked recordsNC_071852.12 linked recordsNC_086485.12 linked recordsNC_046520.12 linked recordsPP272181.12 linked recordsPP272182.12 linked recordsNC_069224.12 linked recordsPZ130073.12 linked recordsON641262.12 linked recordsNC_086487.12 linked recordsNC_088534.12 linked recordsNC_065871.12 linked recordsNC_057235.12 linked recordsNC_050991.12 linked recordsNC_062602.12 linked recordsNC_064367.12 linked recordsNC_048512.11 linked recordOR565921.11 linked recordNC_068628.11 linked recordNC_052696.11 linked recordNC_054294.11 linked recordNC_063508.11 linked recordNC_063509.11 linked recordNC_084107.11 linked recordMW149076.11 linked recordOR548044.11 linked recordOR537888.11 linked recordNC_088747.11 linked recordPV929844.11 linked recordNC_058533.11 linked recordOR537890.11 linked recordOR537889.11 linked recordNC_059786.11 linked recordOR263673.11 linked recordNC_058325.11 linked recordNC_046409.11 linked recordPQ180372.11 linked recordNC_056141.11 linked recordMZ958825.11 linked recordNC_064126.11 linked recordNC_085322.11 linked recordNC_050943.11 linked recordNC_071895.11 linked recordNC_069583.11 linked recordMN165115.11 linked recordNC_054194.11 linked recordNC_058333.11 linked recordPQ963003.11 linked recordPP357159.11 linked recordNC_064501.11 linked recordPP357162.11 linked recordPP357156.11 linked recordNC_056994.11 linked recordNC_063697.11 linked recordPP357161.11 linked recordPP357160.11 linked recordPP357165.11 linked recordPP357155.11 linked recordPP357163.11 linked recordNC_050945.11 linked recordNC_063558.11 linked recordPP357157.11 linked recordPP357164.11 linked recordNC_053828.11 linked recordPX904544.11 linked recordNC_056915.11 linked recordNC_064127.11 linked recordPQ180373.11 linked recordPQ180377.11 linked recordPQ180378.11 linked recordPQ180379.11 linked recordPQ180381.11 linked recordPQ231080.11 linked recordPQ279583.11 linked recordPX283822.11 linked recordPQ231082.11 linked recordPQ231086.11 linked recordPQ414921.11 linked recordOR565909.11 linked recordPQ231089.11 linked recordPV802395.11 linked recordPZ055112.11 linked recordNC_029370.11 linked recordNC_046835.11 linked recordPX569468.11 linked recordPQ231095.11 linked recordPQ231098.11 linked recordPV802396.11 linked recordOR565912.11 linked recordNC_051966.11 linked recordPQ231101.11 linked recordNC_064128.11 linked recordPQ231104.11 linked recordPP056237.11 linked recordOR565917.11 linked recordOR565952.11 linked recordOR565964.11 linked recordOR565945.11 linked recordOP204791.11 linked recordPV600640.11 linked recordPX971240.11 linked recordPX971241.11 linked recordPX971242.11 linked recordPX971243.11 linked recordNC_071750.11 linked recordPX969653.11 linked recordPX394257.11 linked recordPZ101810.11 linked recordPP357188.11 linked recordPZ101792.11 linked recordPZ101804.11 linked recordPZ101799.11 linked recordPZ101811.11 linked recordPZ101803.11 linked recordPZ101796.11 linked recordPZ101809.11 linked recordPZ101794.11 linked recordPZ101797.11 linked recordNC_079688.11 linked recordNC_051544.11 linked recordPV930134.11 linked recordNC_082580.11 linked recordPQ279582.11 linked recordPQ231090.11 linked recordPQ231096.11 linked recordOR565920.11 linked recordOR565938.11 linked recordOR565954.11 linked recordOR565950.11 linked recordOR565962.11 linked recordOR565942.11 linked recordOR565918.11 linked recordOR565957.11 linked recordOR565931.11 linked recordOR565953.11 linked recordOR565927.11 linked recordOR565930.11 linked recordOR565958.11 linked recordPQ231107.11 linked recordOR565934.11 linked recordNC_085355.11 linked recordOR565943.11 linked recordOR565956.11 linked recordOR565939.11 linked recordOR565963.11 linked recordOR565955.11 linked recordOR565935.11 linked recordOR565925.11 linked recordOR565959.11 linked recordOR565913.11 linked recordOR565932.11 linked recordOR565915.11 linked recordOR565944.11 linked recordOR565940.11 linked recordOR565960.11 linked recordPX682502.11 linked recordPV741117.11 linked recordOR565937.11 linked recordOR565948.11 linked recordOR567250.11 linked recordNC_085356.11 linked recordNC_085357.11 linked recordNC_085358.11 linked recordNC_085359.11 linked recordOR565910.11 linked recordPP234524.11 linked recordPV476682.11 linked recordNC_042796.11 linked recordNC_065983.11 linked recordNC_065984.11 linked recordNC_061379.11 linked recordPV870855.11 linked recordPV870856.11 linked recordNC_063911.11 linked recordPX971244.11 linked recordOK094518.11 linked recordPV591959.11 linked recordPX971245.11 linked recordPX971246.11 linked recordNC_063912.11 linked recordPV870857.11 linked recordPV870858.11 linked recordPQ359435.11 linked recordPV870859.11 linked recordOR767373.11 linked recordNC_046838.11 linked recordNC_058852.11 linked recordPV870860.11 linked recordNC_035233.11 linked recordPV870861.11 linked recordPV870862.11 linked recordNC_050896.11 linked recordOR652279.11 linked recordMT012420.11 linked recordPV870863.11 linked recordPX971247.11 linked recordNC_058851.11 linked recordMW435408.11 linked recordNC_038165.11 linked recordPV870864.11 linked recordPX971248.11 linked recordPV870865.11 linked recordNC_050899.11 linked recordNC_050929.11 linked recordMW435409.11 linked recordMK944407.11 linked recordNC_065866.11 linked recordPV870867.11 linked recordNC_050900.11 linked recordPV870868.11 linked recordPV870869.11 linked recordNC_050901.11 linked recordNC_063913.11 linked recordNC_061230.11 linked recordNC_061229.11 linked recordPX971249.11 linked recordPV340582.11 linked recordPV870871.11 linked recordNC_050903.11 linked recordPV480542.11 linked recordPV480544.11 linked recordPQ058237.11 linked recordPQ058240.11 linked recordPQ058275.11 linked recordPQ059215.11 linked recordMW420937.11 linked recordPQ059241.11 linked recordPQ059196.11 linked recordPQ075892.11 linked recordMW420957.11 linked recordPQ059199.11 linked recordPQ075894.11 linked recordNC_057255.11 linked recordMW420978.11 linked recordPQ075899.11 linked recordPQ059208.11 linked recordPQ058277.11 linked recordPQ075900.11 linked recordPQ075901.11 linked recordPQ075902.11 linked recordNC_027262.11 linked recordMW420972.11 linked recordPQ075906.11 linked recordPQ059216.11 linked recordPQ059224.11 linked recordPQ075909.11 linked recordNC_072112.11 linked recordPQ075911.11 linked recordPQ075908.11 linked recordPQ075912.11 linked recordPQ059198.11 linked recordPQ058241.11 linked recordPQ058242.11 linked recordMW420973.11 linked recordPZ130072.11 linked recordOR178745.11 linked recordPQ075918.11 linked recordMW420952.11 linked recordPQ059212.11 linked recordMW420951.11 linked recordMW420974.11 linked recordPQ059399.11 linked recordPQ059226.11 linked recordPQ059304.11 linked recordPQ058279.11 linked recordPQ059227.11 linked recordPZ130068.11 linked recordPQ058280.11 linked recordNC_072113.11 linked recordPQ059292.11 linked recordMW413436.11 linked recordMW420958.11 linked recordPQ059222.11 linked recordPQ058243.11 linked recordPQ059197.11 linked recordPQ059204.11 linked recordMW420965.11 linked recordPQ058239.11 linked recordPQ075885.11 linked recordMW420934.11 linked recordPQ059306.11 linked recordMW420938.11 linked recordMW420941.11 linked recordMW420959.11 linked recordMW420942.11 linked recordPZ130066.11 linked recordPQ058251.11 linked recordMW286270.11 linked recordMW420944.11 linked recordMW420975.11 linked recordNC_072111.11 linked recordPQ059294.11 linked recordPQ059312.11 linked recordPQ059311.11 linked recordPQ059295.11 linked recordPQ058270.11 linked recordPQ059314.11 linked recordPQ058285.11 linked recordPQ059195.11 linked recordPQ059229.11 linked recordPZ130062.11 linked recordPQ075890.11 linked recordPQ059359.11 linked recordPQ058244.11 linked recordPQ058260.11 linked recordPQ059296.11 linked recordMW420940.11 linked recordPQ059316.11 linked recordMW420945.11 linked recordPQ059317.11 linked recordMW420966.11 linked recordPQ059318.11 linked recordNC_057189.11 linked recordPQ059231.11 linked recordPQ075922.11 linked recordMW420976.11 linked recordPQ059319.11 linked recordPQ059320.11 linked recordPQ059360.11 linked recordMW420947.11 linked recordMW420954.11 linked recordMW420936.11 linked recordPQ059322.11 linked recordMW420969.11 linked recordPQ058257.11 linked recordMW420960.11 linked recordPQ059232.11 linked recordPQ059335.11 linked recordPQ059324.11 linked recordMW420933.11 linked recordPQ059223.11 linked recordPQ059343.11 linked recordMW420955.11 linked recordPQ059233.11 linked recordMW420970.11 linked recordPQ059328.11 linked recordPQ059298.11 linked recordMW420964.11 linked recordPQ059330.11 linked recordPQ059313.11 linked recordPQ058238.11 linked recordMW420953.11 linked recordPQ059333.11 linked recordPQ059331.11 linked recordPQ059299.11 linked recordPQ059194.11 linked recordPQ059200.11 linked recordPQ059234.11 linked recordPZ130071.11 linked recordPQ059326.11 linked recordPQ059206.11 linked recordMW420948.11 linked recordMW420935.11 linked recordMW420949.11 linked recordPQ059235.11 linked recordPQ058256.11 linked recordPQ059211.11 linked recordPQ059236.11 linked recordPQ059300.11 linked recordPQ059325.11 linked recordPQ058276.11 linked recordPQ058269.11 linked recordPZ130060.11 linked recordPQ059301.11 linked recordPQ059336.11 linked recordPQ059237.11 linked recordPQ059244.11 linked recordMT982397.11 linked recordPQ058263.11 linked recordMW420939.11 linked recordPQ059337.11 linked recordPQ059210.11 linked recordPQ059338.11 linked recordPQ058254.11 linked recordPQ058255.11 linked recordPQ059339.11 linked recordPQ059189.11 linked recordMW420961.11 linked recordMW420962.11 linked recordPQ059340.11 linked recordPQ059344.11 linked recordPQ059190.11 linked recordPQ059217.11 linked recordPQ059342.11 linked recordPQ059345.11 linked recordMW420977.11 linked recordPQ075921.11 linked recordPQ058272.11 linked recordMW420963.11 linked recordPQ059230.11 linked recordPZ130065.11 linked recordMW420956.11 linked recordPQ058249.11 linked recordMW420967.11 linked recordPZ130069.11 linked recordPQ059348.11 linked recordPQ059349.11 linked recordPQ059191.11 linked recordPQ059238.11 linked recordPQ059239.11 linked recordPQ059351.11 linked recordMW420943.11 linked recordPQ059214.11 linked recordNC_050161.11 linked recordPQ059352.11 linked recordPQ059353.11 linked recordPQ059303.11 linked recordPQ058274.11 linked recordPZ130059.11 linked recordPQ059221.11 linked recordPQ058248.11 linked recordPQ058273.11 linked recordPQ059350.11 linked recordPZ130061.11 linked recordPQ058250.11 linked recordPQ075913.11 linked recordPQ058253.11 linked recordMW286272.11 linked recordPQ058281.11 linked recordPQ058264.11 linked recordPQ059355.11 linked recordPQ058261.11 linked recordPQ059346.11 linked recordPQ059356.11 linked recordPQ059357.11 linked recordNC_082543.11 linked recordPX260186.11 linked recordMT554703.11 linked recordPX260185.11 linked recordPV340612.11 linked recordPV340613.11 linked recordNC_061173.11 linked recordPV340614.11 linked recordMN814872.11 linked recordNC_046822.11 linked recordMW420971.11 linked recordPQ541021.11 linked recordNC_065666.11 linked recordPQ463296.11 linked recordPV226239.11 linked recordPV116304.11 linked recordPV138186.11 linked recordPV138187.11 linked recordMN8148541 linked recordPZ1017881 linked recordPZ1017941 linked recordNC_0613221 linked recordNC_0272621 linked recordNC_0204311 linked recordNC_0307551 linked recordNC_0351431 linked recordNC_0272591 linked recordNC_0537061 linked recordNC_0686351 linked recordNC_0841651 linked recordMN8148521 linked recordMN8148531 linked recordNC_0485121 linked recordPP0245321 linked recordPV2438051 linked recordNC_0841661 linked recordPQ1789891 linked recordNC_0841671 linked recordNC_0718441 linked recordNC_0841681 linked recordPP0245331 linked recordPP0245341 linked recordPV1929271 linked recordOR5659211 linked recordNC_0686281 linked recordNC_0660221 linked recordPP8403381 linked recordPP1032991 linked recordNC_0526961 linked recordNC_0542941 linked recordNC_0583221 linked recordNC_0635081 linked recordLC7752831 linked recordNC_0527481 linked recordNC_0635091 linked recordNC_0841071 linked recordNC_0841751 linked recordMW1490761 linked recordOR5480441 linked recordOR5378881 linked recordNC_0887471 linked recordNC_0583231 linked recordPV9298441 linked recordNC_0583241 linked recordNC_0585331 linked recordOR5378901 linked recordOR5378891 linked recordNC_0597861 linked recordNC_0583251 linked recordNC_0464091 linked recordNC_0357291 linked recordNC_0698331 linked recordMN8148601 linked recordPQ1803721 linked recordNC_0583261 linked recordNC_0563931 linked recordNC_0561411 linked recordNC_0687741 linked recordMZ9588251 linked recordNC_0841761 linked recordNC_0562601 linked recordNC_0561991 linked recordMN8148611 linked recordNC_0731141 linked recordNC_0641261 linked recordNC_0576801 linked recordMN8148621 linked recordNC_0583271 linked recordPP1909431 linked recordPP0245311 linked recordNC_0853221 linked recordNC_0509431 linked recordNC_0718951 linked recordON6412711 linked recordPP1909441 linked recordPX9231211 linked recordNC_0695831 linked recordNC_0583291 linked recordMN1651151 linked recordPQ6347281 linked recordNC_0583301 linked recordNC_0583311 linked recordNC_0583321 linked recordNC_0541941 linked recordNC_0583331 linked recordNC_0583341 linked recordNC_0583351 linked recordNC_0795861 linked recordNC_0681331 linked recordPX9287891 linked recordNC_0625841 linked recordNC_0660371 linked recordNC_0318741 linked recordNC_0612141 linked recordNC_0686821 linked recordPQ9630031 linked recordPX9296661 linked recordNC_0583361 linked recordNC_0575081 linked recordNC_0679481 linked recordOR7018591 linked recordPP3571591 linked recordNC_0645011 linked recordPP3571621 linked recordNC_0679471 linked recordPP3571561 linked recordNC_0569941 linked recordNC_0718451 linked recordNC_0636971 linked recordPP3571611 linked recordPP3571601 linked recordPP3571651 linked recordNC_0680051 linked recordPP3571551 linked recordPP3571631 linked recordNC_0509451 linked recordNC_0635581 linked recordPP3571571 linked recordPP3571641 linked recordNC_0538281 linked recordNC_0718461 linked recordPP1909471 linked recordPP1909481 linked recordPP2031251 linked recordPP2031261 linked recordMK6099281 linked recordPX9045441 linked recordNC_0536201 linked recordNC_0569151 linked recordNC_0298191 linked recordNC_0474861 linked recordPP1650491 linked recordNC_0676421 linked recordNC_0676431 linked recordNC_0676441 linked recordNC_0676451 linked recordNC_0676471 linked recordNC_0676481 linked recordNC_0676491 linked recordNC_0676701 linked recordNC_0676501 linked recordNC_0676511 linked recordNC_0676521 linked recordNC_0677061 linked recordNC_0676461 linked recordON8588441 linked recordON8588431 linked recordNC_0676531 linked recordNC_0676541 linked recordNC_0676551 linked recordNC_0676941 linked recordNC_0676561 linked recordNC_0677791 linked recordNC_0676571 linked recordNC_0677801 linked recordNC_0676961 linked recordNC_0676581 linked recordNC_0677011 linked recordNC_0676591 linked recordNC_0676601 linked recordON8588561 linked recordON8588681 linked recordNC_0676611 linked recordON8588581 linked recordNC_0677811 linked recordNC_0676621 linked recordNC_0676631 linked recordNC_0677821 linked recordON8588641 linked recordON8589031 linked recordNC_0676641 linked recordNC_0676651 linked recordNC_0676951 linked recordNC_0677831 linked recordON8588701 linked recordNC_0676671 linked recordNC_0676681 linked recordNC_0676661 linked recordNC_0676691 linked recordNC_0677051 linked recordNC_0676711 linked recordNC_0677041 linked recordNC_0677001 linked recordNC_0585751 linked recordNC_0676721 linked recordNC_0676731 linked recordNC_0676741 linked recordNC_0676751 linked recordNC_0677071 linked recordNC_0676771 linked recordNC_0676781 linked recordNC_0676971 linked recordNC_0676981 linked recordNC_0677091 linked recordNC_0676991 linked recordNC_0537081 linked recordNC_0676791 linked recordNC_0676801 linked recordNC_0677081 linked recordNC_0676811 linked recordNC_0676821 linked recordNC_0676831 linked recordNC_0677031 linked recordNC_0641271 linked recordNC_0677021 linked recordON8589081 linked recordNC_0676841 linked recordNC_0676851 linked recordNC_0676861 linked recordNC_0676931 linked recordON8589061 linked recordNC_0676871 linked recordNC_0676881 linked recordNC_0676891 linked recordNC_0676901 linked recordNC_0676921 linked recordNC_0676911 linked recordPQ1803731 linked recordPQ1803771 linked recordPQ1803781 linked recordPQ1803791 linked recordNC_0677851 linked recordPV1929251 linked recordPQ1803811 linked recordPQ2310801 linked recordPQ1265301 linked recordPQ1265311 linked recordPX2838221 linked recordPQ2310821 linked recordPQ2310861 linked recordOR5659091 linked recordPP2031351 linked recordPQ2310891 linked recordPV8023951 linked recordPP2031361 linked recordPP3367671 linked recordPZ0551121 linked recordMN2405201 linked recordNC_0293701 linked recordNC_0468351 linked recordPX5694681 linked recordON6412591 linked recordON6412641 linked recordNC_0866291 linked recordNC_0585921 linked recordPQ2310951 linked recordPQ2310981 linked recordNC_0840511 linked recordPV8023961 linked recordOR5659121 linked recordNC_0519661 linked recordPQ2311011 linked recordNC_0641281 linked recordPV5588811 linked recordMT9807921 linked recordNC_0718471 linked recordPQ2311041 linked recordPP0562371 linked recordOR5659171 linked recordOR5659521 linked recordOR5659641 linked recordOR5659451 linked recordOP2047911 linked recordNC_0660331 linked recordPP1650601 linked recordPV6006401 linked recordPX9712401 linked recordNC_0440821 linked recordNC_0320541 linked recordNC_0864891 linked recordNC_0372471 linked recordNC_0864861 linked recordNC_0474751 linked recordPX9712431 linked recordNC_0636871 linked recordNC_0717501 linked recordPX9696531 linked recordPX3942571 linked recordPZ1018101 linked recordPZ1017921 linked recordPZ1018041 linked recordPZ1017991 linked recordPZ1018111 linked recordPZ1018031 linked recordPZ1017961 linked recordPZ1018091 linked recordPZ1017971 linked recordNC_0796881 linked recordNC_0515441 linked recordNC_0718481 linked recordNC_0588821 linked recordNC_0718491 linked recordPV9301341 linked recordPV8376171 linked recordNC_0572831 linked recordNC_0718501 linked recordNC_0796951 linked recordOQ7062751 linked recordOR4781661 linked recordNC_0571961 linked recordMW8296031 linked recordNC_0438731 linked recordNC_0821401 linked recordPQ4686951 linked recordON6412921 linked recordON6413231 linked recordNC_0825801 linked recordPQ2795821 linked recordPQ2310901 linked recordNC_0380621 linked recordPQ2310961 linked recordNC_0677871 linked recordOR5659201 linked recordOR5659381 linked recordOR5659541 linked recordOR5659501 linked recordOR5659621 linked recordOR5659421 linked recordOR5659181 linked recordOR5659571 linked recordOR5659311 linked recordOR5659531 linked recordOR5659271 linked recordOR5659301 linked recordOR5659581 linked recordPQ2311071 linked recordOR5659341 linked recordNC_0853551 linked recordOR5659431 linked recordOR5659561 linked recordNC_0586051 linked recordOR5659391 linked recordOR5659631 linked recordOR5659551 linked recordOR5659351 linked recordOR5659251 linked recordOR5659591 linked recordOR5659131 linked recordOR5659321 linked recordOR5659151 linked recordOR5659441 linked recordOR5659401 linked recordOR5659601 linked recordOR5659371 linked recordOR5659481 linked recordKT2206861 linked recordKT2206851 linked recordKT2206881 linked recordKT2206891 linked recordNC_0307571 linked recordNC_0658681 linked recordMN8148651 linked recordPV9296801 linked recordOP1864671 linked recordNC_0614151 linked recordPX9216491 linked recordNC_0676341 linked recordNC_0853561 linked recordNC_0853571 linked recordNC_0657331 linked recordNC_0700701 linked recordNC_0853581 linked recordNC_0853591 linked recordOR5659101 linked recordNC_0613941 linked recordPP2345241 linked recordNC_0298201 linked recordNC_0853681 linked recordMT3283971 linked recordPV4766821 linked recordNC_0660191 linked recordNC_0427961 linked recordNC_0659831 linked recordNC_0659841 linked recordNC_0314341 linked recordNC_0314331 linked recordNC_0262911 linked recordNC_0613791 linked recordOR6990501 linked recordNC_0844131 linked recordNC_0844141 linked recordNC_0844121 linked recordNC_0396541 linked recordPP2721741 linked recordMN8148661 linked recordMT7402571 linked recordNC_0599061 linked recordMN8148671 linked recordMT1563631 linked recordNC_0677391 linked recordPV8708551 linked recordPV8708561 linked recordNC_0840491 linked recordMT1563711 linked recordNC_0639111 linked recordPX9712441 linked recordPV6012971 linked recordNC_0410921 linked recordNC_0572841 linked recordNC_0677401 linked recordMW3875011 linked recordNC_0401211 linked recordOK0945181 linked recordPV5919591 linked recordPX9712451 linked recordPX9712461 linked recordMT1563641 linked recordNC_0639121 linked recordNC_0597181 linked recordNC_0840451 linked recordNC_0508951 linked recordPV8708571 linked recordNC_0840501 linked recordPV8708581 linked recordPQ3594351 linked recordNC_0840471 linked recordPV8708591 linked recordNC_0677351 linked recordNC_0677361 linked recordNC_0840461 linked recordOR7673731 linked recordNC_0468381 linked recordNC_0588521 linked recordPV8708601 linked recordPV9727761 linked recordMT1563661 linked recordNC_0352331 linked recordMT1563721 linked recordPV6012981 linked recordPV8708611 linked recordNC_0840441 linked recordNC_0677421 linked recordPV9910531 linked recordPV8708621 linked recordNC_0677411 linked recordNC_0840481 linked recordMT1563731 linked recordNC_0508961 linked recordNC_0508971 linked recordMT1563651 linked recordMT0124201 linked recordPV8708631 linked recordOR6845711 linked recordPX9712471 linked recordNC_0588511 linked recordMW4354081 linked recordNC_0508981 linked recordMT1563771 linked recordNC_0677371 linked recordNC_0381651 linked recordPV8708641 linked recordPX9712481 linked recordMT1563741 linked recordPV8708651 linked recordNC_0508991 linked recordNC_0509291 linked recordMW4354091 linked recordPP2721751 linked recordMK9444071 linked recordNC_0658661 linked recordNC_0410911 linked recordMW7522061 linked recordPV8708671 linked recordNC_0677431 linked recordNC_0509001 linked recordMT1563701 linked recordNC_0718511 linked recordMW7522011 linked recordPV8708681 linked recordPV8708691 linked recordNC_0509011 linked recordNC_0639131 linked recordPV6012991 linked recordNC_0612301 linked recordPV9952451 linked recordNC_0500531 linked recordNC_0677381 linked recordNC_0612291 linked recordMT1563691 linked recordPX9712491 linked recordMW7522081 linked recordPP2721761 linked recordPV3405821 linked recordPP2721771 linked recordPV8708711 linked recordNC_0509021 linked recordNC_0509031 linked recordPP3164971 linked recordPV4805421 linked recordNC_0660341 linked recordPV4805441 linked recordNC_0880341 linked recordNC_0880351 linked recordNC_0880361 linked recordNC_0653941 linked recordNC_0674991 linked recordPQ0582371 linked recordPQ0582401 linked recordPQ0582751 linked recordPQ0592151 linked recordMW4209371 linked recordPQ0592411 linked recordPQ0591961 linked recordPQ0758921 linked recordMW4209571 linked recordPQ0591991 linked recordPQ0758941 linked recordNC_0572551 linked recordMW4209781 linked recordPQ0758991 linked recordPQ0592081 linked recordPQ0582771 linked recordPQ0759001 linked recordPQ0759011 linked recordPQ0759021 linked recordNC_0598141 linked recordMW4209721 linked recordPQ0759061 linked recordPQ0592161 linked recordPQ0592241 linked recordMN1283851 linked recordPQ0759091 linked recordNC_0721121 linked recordPQ0759111 linked recordPQ0759081 linked recordPQ0759121 linked recordPZ1300641 linked recordPQ0591981 linked recordPQ0582411 linked recordPQ0582421 linked recordMW4209731 linked recordPZ1300721 linked recordOR1787451 linked recordPQ0759181 linked recordMW4209521 linked recordPQ0592121 linked recordMW4209511 linked recordMW4209741 linked recordPQ0593991 linked recordPQ0592261 linked recordPQ0593041 linked recordPQ0582791 linked recordPQ0592271 linked recordPZ1300681 linked recordPQ0582801 linked recordNC_0721131 linked recordNC_0598131 linked recordPQ0592921 linked recordMW4134361 linked recordMW4209581 linked recordPZ1300671 linked recordPQ0592221 linked recordPQ0582431 linked recordPQ0591971 linked recordPQ0592041 linked recordMW4209651 linked recordPQ0582391 linked recordPQ0758851 linked recordMW4209341 linked recordPQ0593061 linked recordMW4209381 linked recordMW4209411 linked recordMW4209591 linked recordMW4209421 linked recordPZ1300661 linked recordPQ0582511 linked recordMW2862701 linked recordMW4209441 linked recordMW4209751 linked recordNC_0721111 linked recordMN0473121 linked recordPQ0592941 linked recordPQ0593121 linked recordPQ0593111 linked recordNC_0285331 linked recordPQ0592951 linked recordPZ1300701 linked recordPQ0582701 linked recordPQ0593141 linked recordPQ0582851 linked recordPQ0591951 linked recordMN1283891 linked recordPQ0592291 linked recordPZ1300621 linked recordPQ0758901 linked recordPQ0593591 linked recordPQ0582441 linked recordPQ0582601 linked recordPQ0592961 linked recordMW4209401 linked recordNC_0614161 linked recordPQ0593161 linked recordMW4209451 linked recordPQ0593171 linked recordMW4209661 linked recordPQ0593181 linked recordNC_0571891 linked recordPQ0592311 linked recordPQ0759221 linked recordMW4209761 linked recordPQ0593191 linked recordPQ0593201 linked recordPQ0593601 linked recordMN1283841 linked recordMW4209471 linked recordMW4209541 linked recordMW4209361 linked recordPQ0593221 linked recordMW4209691 linked recordPQ0582571 linked recordMW4209601 linked recordPQ0592321 linked recordPQ0593351 linked recordPQ0593241 linked recordMW4209331 linked recordPQ0592231 linked recordPQ0593431 linked recordMW4209551 linked recordPQ0592331 linked recordMW4209701 linked recordPQ0593281 linked recordPQ0592981 linked recordMW4209641 linked recordPQ0593301 linked recordPQ0593131 linked recordPQ0582381 linked recordMW4209531 linked recordPQ0593331 linked recordPQ0593311 linked recordPQ0592991 linked recordPQ0591941 linked recordPQ0592001 linked recordPQ0592341 linked recordPZ1300711 linked recordPQ0593261 linked recordPQ0592061 linked recordMW4209481 linked recordMW4209351 linked recordMW4209491 linked recordPQ0592351 linked recordPQ0582561 linked recordPQ0592111 linked recordPQ0592361 linked recordPQ0593001 linked recordPQ0593251 linked recordPQ0582761 linked recordPQ0582691 linked recordPZ1300601 linked recordPQ0593011 linked recordPQ0593361 linked recordPQ0592371 linked recordPQ0592441 linked recordMT9823971 linked recordPQ0582631 linked recordMW4209391 linked recordPQ0593371 linked recordPQ0592101 linked recordPQ0593381 linked recordPZ1300631 linked recordPQ0582541 linked recordPQ0582551 linked recordNC_0528831 linked recordPQ0593391 linked recordPQ0591891 linked recordMW4209611 linked recordMW4209621 linked recordPQ0593401 linked recordPQ0593441 linked recordPQ0591901 linked recordPQ0592171 linked recordPQ0593421 linked recordPQ0593451 linked recordMW4209771 linked recordPQ0759211 linked recordMW4209631 linked recordPQ0592301 linked recordPZ1300651 linked recordMW4209561 linked recordPQ0582491 linked recordMW4209671 linked recordPZ1300691 linked recordPQ0593481 linked recordPQ0593491 linked recordPQ0591911 linked recordPQ0592381 linked recordPQ0592391 linked recordPQ0593511 linked recordMW4209431 linked recordPQ0592141 linked recordNC_0501611 linked recordNC_0598121 linked recordPQ0593521 linked recordPQ0593531 linked recordPQ0593031 linked recordPQ0582741 linked recordPZ1300591 linked recordPQ0592211 linked recordPQ0582481 linked recordPQ0582731 linked recordPQ0593501 linked recordPZ1300611 linked recordPQ0582501 linked recordPQ0759131 linked recordPQ0582531 linked recordMW2862721 linked recordPQ0582811 linked recordPQ0582641 linked recordPQ0593551 linked recordPQ0582611 linked recordPQ0593461 linked recordPQ0593561 linked recordPQ0593571 linked recordNC_0628031 linked recordNC_0298251 linked recordNC_0298221 linked recordNC_0298231 linked recordNC_0825431 linked recordPX2601861 linked recordMT5547031 linked recordPX2601851 linked recordPP2721781 linked recordPP2721801 linked recordNC_0298241 linked recordNC_0298181 linked recordNC_0200981 linked recordPV3406121 linked recordPP2721831 linked recordPV3406131 linked recordNC_0611731 linked recordPP2721841 linked recordMN8148711 linked recordMN8148641 linked recordPV3406141 linked recordMN8148721 linked recordMH3251331 linked recordNC_0864881 linked recordNC_0468221 linked recordNC_0718521 linked recordNC_0864851 linked recordNC_0465201 linked recordPP2721811 linked recordPP2721821 linked recordNC_0692241 linked recordPZ1300731 linked recordON6412621 linked recordNC_0864871 linked recordMW4209711 linked recordNC_0885341 linked recordNC_0658711 linked recordNC_0572351 linked recordPQ5410211 linked recordNC_0656661 linked recordNC_0509911 linked recordNC_0626021 linked recordPQ4632961 linked recordNC_0643671 linked recordPV2262391 linked recordPV1163041 linked recordPV1381861 linked recordPV1381871 linked recordOK064490.11 linked record