Ajuga decumbensATP12361 bp ·
PV972819ATGACACTCTCTCCCAAAGCAGCGGAACTAACGACTCTATTAGAAAGTAGAATTAGTCACTTTTACACGAATTTTCAAGTGGATGAGATC…
Gene evidence record
ATP synthase subunit 1
Curated function is shown separately from locus and sequence evidence.
A conserved mitochondrial ATP synthase locus.
Species-level DNA, coordinate and organelle coverage for this symbol.
| Species | Taxonomy | Organelle | DNA records | Coordinate loci | Accessions | |
|---|---|---|---|---|---|---|
| Ajuga campylantha | AjugoideaeAjuga | mitochondrial | 0 | 1 | MT277323.1 | Species evidence |
| Ajuga campylanthoides | AjugoideaeAjuga | mitochondrial | 0 | 1 | MT277184.1 | Species evidence |
| Ajuga chamaepitys | AjugoideaeAjuga | mitochondrial | 0 | 1 | OY282509.1 | Species evidence |
| Ajuga ciliata | AjugoideaeAjuga | mitochondrial | 0 | 1 | MT075725.1 | Species evidence |
| Ajuga decumbens | AjugoideaeAjuga | mitochondrial | 1 | 1 | PV972819PV972819.1 | Species evidence |
| Ajuga lupulina | AjugoideaeAjuga | mitochondrial | 0 | 1 | MT277267.1 | Species evidence |
| Ajuga reptans | AjugoideaeAjuga | mitochondrial | 1 | 1 | KF709392KF709392.1 | Species evidence |
| Anisomeles indica | LamioideaeAnisomeles | mitochondrial | 1 | 1 | PP554241PP554241.1 | Species evidence |
| Ballota nigra | LamioideaeBallota | mitochondrial | 0 | 1 | OX344733.1 | Species evidence |
| Callicarpa americana | CallicarpoideaeCallicarpa | mitochondrial | 1 | 2 | PX121882PX121882.1 | Species evidence |
| Callicarpa nudiflora | CallicarpoideaeCallicarpa | mitochondrial | 1 | 1 | PX091360PX091360.1 | Species evidence |
| Caryopteris mongholica | AjugoideaeCaryopteris | mitochondrial | 0 | 1 | MT277261.1 | Species evidence |
| Elsholtzia blanda | NepetoideaeElsholtzia | mitochondrial | 1 | 1 | PP755340PP755340.1 | Species evidence |
| Galeopsis tetrahit | LamioideaeGaleopsis | mitochondrial | 0 | 1 | OY776138.1 | Species evidence |
| Glechoma hederacea | NepetoideaeGlechoma | mitochondrial | 0 | 1 | OZ258497.1 | Species evidence |
| Glechoma longituba | NepetoideaeGlechoma | mitochondrial | 0 | 1 | glechoma_longituba_01 | Species evidence |
| Lamium amplexicaule | LamioideaeLamium | mitochondrial | 0 | 1 | OZ060788.1 | Species evidence |
| Lavandula angustifolia | NepetoideaeLavandula | mitochondrial | 1 | 1 | OR296704OR296704.1 | Species evidence |
| Leonurus japonicus | LamioideaeLeonurus | mitochondrial | 1 | 2 | C_AA079493.1 | Species evidence |
| Melittis melissophyllum | LamioideaeMelittis | mitochondrial | 0 | 1 | OZ218192.1 | Species evidence |
| Mentha aquatica | NepetoideaeMentha | mitochondrial | 0 | 1 | OZ278035.1 | Species evidence |
| Mentha spicata | NepetoideaeMentha | mitochondrial | 0 | 1 | ON631245.1 | Species evidence |
| Mosla chinensis | NepetoideaeMosla | mitochondrial | 0 | 1 | Mosla_chin_20 | Species evidence |
| Ocimum basilicum | NepetoideaeOcimum | mitochondrial | 0 | 1 | PZ530181.1 | Species evidence |
| Paraleonurus japonicus | LamioideaeParaleonurus | mitochondrial | 1 | 1 | PV368446PV368446.1 | Species evidence |
| Perilla frutescens | NepetoideaePerilla | mitochondrial | 1 | 1 | C_AA059311C_AA059311.1 | Species evidence |
| Perilla frutescens var. hirtella | NepetoideaePerilla | mitochondrial | 1 | 1 | PQ048223PQ048223.1 | Species evidence |
| Phlomoides rotata | LamioideaePhlomoides | mitochondrial | 1 | 1 | PV591333PV591333.1 | Species evidence |
| Platostoma chinense | NepetoideaePlatostoma | mitochondrial | 1 | 1 | OP537517OP537517.1 | Species evidence |
| Pogostemon heyneanus | LamioideaePogostemon | mitochondrial | 1 | 1 | MK728874MK728874.1 | Species evidence |
| Prunella vulgaris | NepetoideaePrunella | mitochondrial | 1 | 1 | OR113011OR113011.1 | Species evidence |
| Rotheca serrata | AjugoideaeRotheca | mitochondrial | 1 | 1 | MT075727MT075727.1 | Species evidence |
| Salvia hispanica | NepetoideaeSalvia | mitochondrial | 0 | 1 | CM056166.1 | Species evidence |
| Salvia miltiorrhiza | NepetoideaeSalvia | mitochondrial | 1 | 1 | KF177345NC_023209.1 | Species evidence |
| Salvia officinalis | NepetoideaeSalvia | mitochondrial | 0 | 1 | OQ001564.1 | Species evidence |
| Salvia rosmarinus | NepetoideaeSalvia | mitochondrial | 1 | 1 | PP992923PP992923.1 | Species evidence |
| Scutellaria amoena | ScutellarioideaeScutellaria | mitochondrial | 0 | 1 | MT277181.1 | Species evidence |
| Scutellaria barbata | ScutellarioideaeScutellaria | mitochondrial | 1 | 1 | MZ127834MZ127834.1 | Species evidence |
| Scutellaria cypria | ScutellarioideaeScutellaria | mitochondrial | 1 | 1 | OR344312OR344312.1 | Species evidence |
| Scutellaria franchetiana | ScutellarioideaeScutellaria | mitochondrial | 1 | 1 | MZ127835MZ127835.1 | Species evidence |
| Scutellaria galericulata | ScutellarioideaeScutellaria | mitochondrial | 0 | 1 | OX335799.1 | Species evidence |
| Scutellaria insignis | ScutellarioideaeScutellaria | mitochondrial | 1 | 1 | PX505256PX505256.1 | Species evidence |
| Scutellaria minor | ScutellarioideaeScutellaria | mitochondrial | 0 | 1 | OX940739.1 | Species evidence |
| Scutellaria strigillosa | ScutellarioideaeScutellaria | mitochondrial | 1 | 1 | PX505255PX505255.1 | Species evidence |
| Scutellaria tsinyunensis | ScutellarioideaeScutellaria | mitochondrial | 1 | 1 | MW553042MW553042.1 | Species evidence |
| Stachys alpina | LamioideaeStachys | mitochondrial | 0 | 1 | OZ244443.1 | Species evidence |
| Teucrium botrys | AjugoideaeTeucrium | mitochondrial | 0 | 1 | OZ318414.1 | Species evidence |
| Teucrium ornatum | AjugoideaeTeucrium | mitochondrial | 0 | 1 | MT277161.1 | Species evidence |
| Teucrium scorodonia | AjugoideaeTeucrium | mitochondrial | 0 | 1 | OZ243853.1 | Species evidence |
| Vitex negundo var. cannabifolia | ViticoideaeVitex | mitochondrial | 1 | 1 | PQ493832PQ493832.1 | Species evidence |
| Vitex trifolia | ViticoideaeVitex | mitochondrial | 0 | 1 | OK563725.1 | Species evidence |
Raw accession, coordinate range, strand and feature type remain visible. Duplicate copies within an assembly are not collapsed.
Only nucleotide records are publicly exposed. Protein sequences are intentionally omitted.
PV972819ATGACACTCTCTCCCAAAGCAGCGGAACTAACGACTCTATTAGAAAGTAGAATTAGTCACTTTTACACGAATTTTCAAGTGGATGAGATC…
KF177345ATGGAACTCTCTCCCAGAGCTGCAGAACTAACGACTCTATTAGAAAGTCGAATTAGCAACTTTTACACGAATTTTCAAGTGGATGAGATC…
C_AA059311ATGGAACTCTCTCCCAGAGCTGCAGAACTAACGACTCTATTAGAAAGTCGAATTAGCAACTTTTACACGAATTTTCAAGTGGATGAGATC…
C_AA079493.1ATGGAACTCTCTCCCAGAGCTGCAGAACTAACCACTCTATTAGAAAGTCGAATTAGCCACTTTTACACGAATTTTCAAGTGGATGAGATC…
PP992923ATGGAACTCTCTCCCAGAGCTGCAGAACTAACGACTCTATTAGAAAGTCGAATTAGCAACTTTTACACGAATTTTCAAGTGGATGAGATC…
KF709392ATGACACTCTCTCCCAAAGCAGCGGAACTAACGACTCTATTAGAAAGTCGAATTAGTCACTTTTACACGAATTTTCAAGTGGATGAGATC…
PP554241ATGGAACTCTCTCCCAGAGCTGCAGAACTAACCACTCTATTAGAAAGTCGAATTAGCAACTTTTACACGAATTTTCAAGTGGATGAGATC…
PX121882ATGGAACTCTCTCCCAGAGCTGCAGAACTAACCACTCTATTAGAAAGTCGAATTAGCAACTTTTACACGAATTTTCAAGTGGATGAGATC…
PX091360ATGGAACTCTCTCCCAGAGCTGCAGAACTAACCACTCTATTAGAAAGTCGAATTAGCAACTTTTACACGAATTTTCAAGTGGATGAGATC…
PP755340ATGGAACTCTCTCCCAGAGCTGCAGAACTAACGACTCTATTAGAAAGTCGAATTAGCAACTTTTACACGAATTTTCAAGTGGATGAGATC…
OR296704ATGGAACTCTCTCCCAGAGCTGCAGAACTAACGACTCTATTAGAAAGTCGAATTAGCAACTTTTACACGAATTTTCAAGTGGATGAGATC…
PV368446ATGGAACTCTCTCCCAGAGCTGCAGAACTAACCACTCTATTAGAAAGTCGAATTAGCCACTTTTACACGAATTTTCAAGTGGATGAGATC…
PQ048223ATGGAACTCTCTCCCAGAGCTGCAGAACTAACGACTCTATTAGAAAGTCGAATTAGCAACTTTTACACGAATTTTCAAGTGGATGAGATC…
PV591333ATGGAACTCTCTCCCAGAGCTGCAGAACTAACCACTCTATTAGAAAGTAGAATTAGCCACTTTTACACGAATTTTCAAGTGGATGAGATC…
OP537517ATGGAACTCTCTCCCAGAGCTGCAGAACTAACGACTCTATTAGAAAGTCGAATTAGCAACTTTTACACGAATTTTCAAGTGGATGAGATC…
MK728874ATGGAACTCTCTCCCAGAGCTGCAGAACTAACCACTCTATTAGAAAGTCGAATTAGCAACTTTTACACGAATTTTCAAGTGGATGAGATC…
OR113011ATGGAACTCTCTCCCAGAGCTGCAGAACTAACGACTCTATTAGAAAGTCGAATTAGCAACTTTTACACGAATTTTCAAGTGGATGAGATC…
MT075727ATGGAACTCTCTCCCAGAGCTGCAGAACTCACGACTCTATTAGAAAGTCGAATTAGCCACTTTTACACGAATTTTCAAGTGGATGAGATC…
MZ127834ATGGAACTCTCTCCCAGAGCTGCAGAACTAACGACTCTATTAGAAAGTCGAATTAGCAACTTTTACACAAATTTTCAAGTGGATGAGATC…
OR344312ATGGAACTCTCTCCCAGAGCTGCAGAACTAACGACTCTATTAGAAAGTCGAATTAGCAACTTTTACACAAATTTTCAAGTGGATGAGATC…
MZ127835ATGGAACTCTCTCCCAGAGCTGCAGAACTAACGACTCTATTAGAAAGTCGAATTAGCAACTTTTACACAAATTTTCAAGTGGATGAGATC…
PX505256ATGGAACTCTCTCCCAGAGCTGCAGAACTAACGACTCTATTAGAAAGTCGAATTAGCAACTTTTACACAAATTTTCAAGTGGATGAGATC…
PX505255ATGGAACTCTCTCCCAGAGCTGCAGAACTAACGACTCTATTAGAAAGTCGAATTAGCAACTTTTACACAAATTTTCAAGTGGATGAGATC…
MW553042ATGGAACTCTCTCCCAGAGCTGCAGAACTAACGACTCTATTAGAAAGTCGAATTAGCAACTTTTACACAAATTTTCAAGTGGATGAGATC…
Traceable identifiers associated with this gene evidence.
C_AA079493.13 linked recordsPX121882.12 linked recordsMT277323.11 linked recordMT277184.11 linked recordOY282509.11 linked recordMT075725.11 linked recordPV972819.11 linked recordMT277267.11 linked recordKF709392.11 linked recordPP554241.11 linked recordOX344733.11 linked recordPX091360.11 linked recordMT277261.11 linked recordPP755340.11 linked recordOY776138.11 linked recordOZ258497.11 linked recordglechoma_longituba_011 linked recordOZ060788.11 linked recordOR296704.11 linked recordOZ218192.11 linked recordOZ278035.11 linked recordON631245.11 linked recordMosla_chin_201 linked recordPZ530181.11 linked recordPV368446.11 linked recordC_AA059311.11 linked recordPQ048223.11 linked recordPV591333.11 linked recordOP537517.11 linked recordMK728874.11 linked recordOR113011.11 linked recordMT075727.11 linked recordCM056166.11 linked recordNC_023209.11 linked recordOQ001564.11 linked recordPP992923.11 linked recordMT277181.11 linked recordMZ127834.11 linked recordOR344312.11 linked recordMZ127835.11 linked recordOX335799.11 linked recordPX505256.11 linked recordOX940739.11 linked recordPX505255.11 linked recordMW553042.11 linked recordOZ244443.11 linked recordOZ318414.11 linked recordMT277161.11 linked recordOZ243853.11 linked recordPQ493832.11 linked recordOK563725.11 linked recordPV9728191 linked recordKF1773451 linked recordC_AA0593111 linked recordPP9929231 linked recordKF7093921 linked recordPP5542411 linked recordPX1218821 linked recordPX0913601 linked recordPP7553401 linked recordOR2967041 linked recordPV3684461 linked recordPQ0482231 linked recordPV5913331 linked recordOP5375171 linked recordMK7288741 linked recordOR1130111 linked recordMT0757271 linked recordMZ1278341 linked recordOR3443121 linked recordMZ1278351 linked recordPX5052561 linked recordPX5052551 linked recordMW5530421 linked recordPQ4938321 linked record