Salvia miltiorrhizanad12214 bp ·
KF177345ATGTACATAGCTGTTCCAGCTGAAATACTTGGAATAATTCTACCACTTCTACTAGGAGTAGCCTTTTTAGTGCTAGCTGAACGTAAAGTA…
Gene evidence record
nad1
NADH dehydrogenase subunit 1
Species with evidence57
DNA records23
Coordinate loci67
Organelle assemblies57
Evidence stateAvailable
Functional annotation
Curated function is shown separately from locus and sequence evidence.
Frequently used to evaluate exon structure and editing in plant mitogenomes.
Species evidence
Species-level DNA, coordinate and organelle coverage for this symbol.
| Species | Taxonomy | Organelle | DNA records | Coordinate loci | Accessions | |
|---|---|---|---|---|---|---|
| Ajuga campylantha | AjugoideaeAjuga | mitochondrial | 0 | 1 | MT277325.1 | Species evidence |
| Ajuga campylanthoides | AjugoideaeAjuga | mitochondrial | 0 | 1 | MT277308.1 | Species evidence |
| Ajuga chamaepitys | AjugoideaeAjuga | mitochondrial | 0 | 1 | OY282509.1 | Species evidence |
| Ajuga ciliata | AjugoideaeAjuga | mitochondrial | 0 | 1 | MT075725.1 | Species evidence |
| Ajuga forrestii | AjugoideaeAjuga | mitochondrial | 0 | 1 | MT277171.1 | Species evidence |
| Ajuga lupulina | AjugoideaeAjuga | mitochondrial | 0 | 1 | MT277223.1 | Species evidence |
| Ajuga nipponensis | AjugoideaeAjuga | mitochondrial | 0 | 4 | MT277175.1 | Species evidence |
| Ajuga reptans | AjugoideaeAjuga | mitochondrial | 1 | 1 | KF709392KF709392.1 | Species evidence |
| Amethystea caerulea | AjugoideaeAmethystea | mitochondrial | 0 | 2 | MT277173.1 | Species evidence |
| Anisomeles indica | LamioideaeAnisomeles | mitochondrial | 1 | 1 | PP554241PP554241.1 | Species evidence |
| Ballota nigra | LamioideaeBallota | mitochondrial | 0 | 1 | OX344733.1 | Species evidence |
| Callicarpa americana | CallicarpoideaeCallicarpa | mitochondrial | 1 | 1 | PX121882PX121882.1 | Species evidence |
| Callicarpa nudiflora | CallicarpoideaeCallicarpa | mitochondrial | 1 | 1 | PX091360PX091360.1 | Species evidence |
| Caryopteris mongholica | AjugoideaeCaryopteris | mitochondrial | 0 | 1 | MT277226.1 | Species evidence |
| Clerodendrum mandarinorum | AjugoideaeClerodendrum | mitochondrial | 0 | 3 | MT277191.1 | Species evidence |
| Dracocephalum rupestre | NepetoideaeDracocephalum | mitochondrial | 1 | 1 | dracocephalum_rupe_01 | Species evidence |
| Elsholtzia blanda | NepetoideaeElsholtzia | mitochondrial | 1 | 1 | PP755340PP755340.1 | Species evidence |
| Galeopsis tetrahit | LamioideaeGaleopsis | mitochondrial | 0 | 1 | OY776136.1 | Species evidence |
| Glechoma hederacea | NepetoideaeGlechoma | mitochondrial | 0 | 1 | OZ258497.1 | Species evidence |
| Glechoma longituba | NepetoideaeGlechoma | mitochondrial | 0 | 1 | glechoma_longituba_01 | Species evidence |
| Lamium amplexicaule | LamioideaeLamium | mitochondrial | 0 | 1 | OZ060788.1 | Species evidence |
| Lavandula angustifolia | NepetoideaeLavandula | mitochondrial | 1 | 1 | OR296704OR296704.1 | Species evidence |
| Leonurus japonicus | LamioideaeLeonurus | mitochondrial | 1 | 1 | C_AA079493.1 | Species evidence |
| Melittis melissophyllum | LamioideaeMelittis | mitochondrial | 0 | 1 | OZ218192.1 | Species evidence |
| Mentha aquatica | NepetoideaeMentha | mitochondrial | 0 | 1 | OZ278035.1 | Species evidence |
| Mentha spicata | NepetoideaeMentha | mitochondrial | 0 | 1 | ON631245.1 | Species evidence |
| Mosla chinensis | NepetoideaeMosla | mitochondrial | 0 | 1 | Mosla_chin_9 | Species evidence |
| Mosla soochowensis | NepetoideaeMosla | mitochondrial | 0 | 1 | Mosla_sooc_2 | Species evidence |
| Ocimum basilicum | NepetoideaeOcimum | mitochondrial | 0 | 1 | PZ530181.1 | Species evidence |
| Perilla frutescens | NepetoideaePerilla | mitochondrial | 1 | 1 | C_AA059311C_AA059311.1 | Species evidence |
| Perilla frutescens var. hirtella | NepetoideaePerilla | mitochondrial | 1 | 1 | PQ048223PQ048223.1 | Species evidence |
| Phlomoides alpina | LamioideaePhlomoides | mitochondrial | 0 | 1 | MT277315.1 | Species evidence |
| Platostoma chinense | NepetoideaePlatostoma | mitochondrial | 1 | 1 | OP537517OP537517.1 | Species evidence |
| Pogostemon heyneanus | LamioideaePogostemon | mitochondrial | 1 | 1 | MK728874MK728874.1 | Species evidence |
| Prunella vulgaris | NepetoideaePrunella | mitochondrial | 1 | 1 | OR113011OR113011.1 | Species evidence |
| Pseudocaryopteris paniculata | AjugoideaePseudocaryopteris | mitochondrial | 0 | 1 | MT277169.1 | Species evidence |
| Rotheca serrata | AjugoideaeRotheca | mitochondrial | 1 | 1 | MT075727MT075727.1 | Species evidence |
| Salvia hispanica | NepetoideaeSalvia | mitochondrial | 0 | 1 | CM056166.1 | Species evidence |
| Salvia miltiorrhiza | NepetoideaeSalvia | mitochondrial | 1 | 1 | KF177345NC_023209.1 | Species evidence |
| Salvia officinalis | NepetoideaeSalvia | mitochondrial | 0 | 1 | OQ001564.1 | Species evidence |
| Salvia rosmarinus | NepetoideaeSalvia | mitochondrial | 1 | 1 | PP992923PP992923.1 | Species evidence |
| Salvia splendens | NepetoideaeSalvia | mitochondrial | 0 | 1 | OQ675154.1 | Species evidence |
| Scutellaria amoena | ScutellarioideaeScutellaria | mitochondrial | 0 | 1 | MT277264.1 | Species evidence |
| Scutellaria barbata | ScutellarioideaeScutellaria | mitochondrial | 1 | 1 | MZ127834MZ127834.1 | Species evidence |
| Scutellaria cypria | ScutellarioideaeScutellaria | mitochondrial | 1 | 1 | OR344312OR344312.1 | Species evidence |
| Scutellaria franchetiana | ScutellarioideaeScutellaria | mitochondrial | 1 | 1 | MZ127835MZ127835.1 | Species evidence |
| Scutellaria galericulata | ScutellarioideaeScutellaria | mitochondrial | 0 | 1 | OX335799.1 | Species evidence |
| Scutellaria insignis | ScutellarioideaeScutellaria | mitochondrial | 1 | 1 | PX505256PX505256.1 | Species evidence |
| Scutellaria minor | ScutellarioideaeScutellaria | mitochondrial | 0 | 1 | OX940739.1 | Species evidence |
| Scutellaria strigillosa | ScutellarioideaeScutellaria | mitochondrial | 1 | 1 | PX505255PX505255.1 | Species evidence |
| Scutellaria tsinyunensis | ScutellarioideaeScutellaria | mitochondrial | 1 | 1 | MW553042MW553042.1 | Species evidence |
| Stachys alpina | LamioideaeStachys | mitochondrial | 0 | 1 | OZ244445.1 | Species evidence |
| Tectona grandis | TectonoideaeTectona | mitochondrial | 0 | 5 | MT277158.1 | Species evidence |
| Teucrium botrys | AjugoideaeTeucrium | mitochondrial | 0 | 1 | OZ318413.1 | Species evidence |
| Teucrium scorodonia | AjugoideaeTeucrium | mitochondrial | 0 | 1 | OZ243853.1 | Species evidence |
| Vitex negundo var. cannabifolia | ViticoideaeVitex | mitochondrial | 1 | 1 | PQ493832PQ493832.1 | Species evidence |
| Vitex trifolia | ViticoideaeVitex | mitochondrial | 0 | 1 | OK563725.1 | Species evidence |
Coordinate-linked loci
Raw accession, coordinate range, strand and feature type remain visible. Duplicate copies within an assembly are not collapsed.
Publication-safe DNA records
Only nucleotide records are publicly exposed. Protein sequences are intentionally omitted.
Perilla frutescensnad1390 bp ·
C_AA059311ATGTACATAGCTGTTCCAGCTGAAATACTTGGAATAATTCTACCACTTCTACTAGGAGTAGCCTTTTTAGTGCTAGCTGAACGTAAAGTA…
Leonurus japonicusnad1390 bp ·
C_AA079493.1ATGTACATAGCTCTTCCAGCTGAAATACTTGGAATAATTCTACCACTTCTACTAGGAGTAGCCTTTTTAGTGCTAGCTGAACGTAAAGTA…
Salvia rosmarinusnad13201 bp ·
PP992923ATGTACATAGCTGTTCCAGCTGAAATACTTGGAATAATTCTACCACTTCTACTAGGAGTAGCCTTTTTAGTGCTAGCTGAACGTAAAGTA…
Ajuga reptansnad12218 bp ·
KF709392ATGTACATAGCTCTTCCAGCTGAAATACTTGGAATAATTCTACCACTTCTACTAGGAGTAGCCTTTTTAGTGCTAGCTGAACGTAAAGTA…
Anisomeles indicanad12230 bp ·
PP554241ATGTACATAGCTCTTCCAGCGGAAATACTTGGAATAATTCTACCACTTCTACTAGGAGTAGCCTTTTTAGTGCTAGCTGAACGTAAAGTA…
Callicarpa americananad12228 bp ·
PX121882ATGTACATAGCTCTTCCAGCTGAAATACTTGGAATAATTCTACCACTTCTACTAGGAGTAGCCTTTTTAGTGCTAGCTGAACGTAAAGTA…
Callicarpa nudifloranad12219 bp ·
PX091360ATGTACATAGCTCTTCCAGCTGAAATACTTGGAATAATTCTACCACTTCTACTAGGAGTAGCCTTTTTAGTGCTAGCTGAACGTAAAGTA…
Elsholtzia blandanad12226 bp ·
PP755340ATGTACATAGCTGTTCCAGCTGAAATACTTGGAATAATTCTACCACTTCTACTAGGAGTAGCCTTTTTAGTGCTAGCTGAACGTAAAGTA…
Lavandula angustifolianad12200 bp ·
OR296704ATGTACATAGCTGTTCCAGCTGAAATACTTGGAATAATTCTACCACTTCTACTAGGAGTAGCCTTTTTAGTGCTAGCTGAACGTAAAGTA…
Perilla frutescens var. hirtellanad12231 bp ·
PQ048223ATGTACATAGCTGTTCCAGCTGAAATACTTGGAATAATTCTACCACTTCTACTAGGAGTAGCCTTTTTAGTGCTAGCTGAACGTAAAGTA…
Platostoma chinensenad11848 bp ·
OP537517ATGTACATAGCTGTTCCAGCTGAAATACTTGGAATAATTCTACCACTTCTACTAGGAGTAGCCTTTTTAGTGCTAGCTGAACGTAAAGTA…
Pogostemon heyneanusnad1921 bp ·
MK728874ATGTACATAGCTCTTCCAGCGGAAATACTTGGAATAATTCTACCACTTCTACTAGGAGTAGCCTTTTTAGTGCTAGCTGAACGTAAAGTA…
Prunella vulgarisnad11857 bp ·
OR113011ATGTACATAGCTGTTCCAGCCGAAATACTTGGAATAATTCTACCACTTCTACTAGGAGTAGCCTTTTTAGTGCTAGCTGAACGTAAAGTA…
Rotheca serratanad12233 bp ·
MT075727ATGTACATAGCTCTTCCAGCTGAAATACTTGGAATCATTCTACCACTTCTACTAGGAGTAGCCTTTTTAGTGCTAGCTGAACGTAAAGTC…
Scutellaria barbatanad1390 bp ·
MZ127834ATGTACATAGCTCTTCCAGCTGAAATACTTGGAATAATTCTACCACTTCTACTAGGAGTAGCCTTTTTAGTGCTAGCTGAACGTAAAGTA…
Scutellaria cyprianad1978 bp ·
OR344312ATGTACATAGCTCTTCCAGCTGAAATACTTGGAATAATTCTACCACTTCTACTAGGAGTAGCCTTTTTAGTGCTAGCTGAACGTAAAGTA…
Scutellaria franchetiananad1390 bp ·
MZ127835ATGTACATAGCTCTTCCAGCTGAAATACTTGGAATAATTCTACCACTTCTACTAGGAGTAGCCTTTTTAGTGCTAGCTGAACGTAAAGTA…
Scutellaria insignisnad1390 bp ·
PX505256ATGTACATAGCTCTTCCAGCTGAAATACTTGGAATAATTCTACCACTTCTACTAGGAGTAGCCTTTTTAGTGCTAGCTGAACGTAAAGTA…
Scutellaria strigillosanad1390 bp ·
PX505255ATGTACATAGCTCTTCCAGCTGAAATACTTGGAATAATTCTACCACTTCTACTAGGAGTAGCCTTTTTAGTGCTAGCTGAACGTAAAGTA…
Scutellaria tsinyunensisnad12236 bp ·
MW553042ATGTACATAGCTCTTCCAGCTGAAATACTTGGAATAATTCTACCACTTCTACTAGGAGTAGCCTTTTTAGTGCTAGCTGAACGTAAAGTC…
Vitex negundo var. cannabifolianad12228 bp ·
PQ493832ATGTACATAGCTCTTCCAGCTGAAATACTTGGAATAATTCTACCACTTCTACTAGGAGTAGCCTTTTTAGTGCTAGCTGAACGTAAAGTA…
Dracocephalum rupestrenad1309 bp ·
dracocephalum_rupe_01GAACGTAAAGTAATGGCTTTTGTGCAACGTCGAAAGGGTCCTGATGTAGTGGGATCGTTTGGATTGTTACAACCTCTAGCAGATGGTTTG…
Accessions
Traceable identifiers associated with this gene evidence.
MT277158.15 linked recordsMT277175.14 linked recordsMT277191.13 linked recordsMT277173.12 linked recordsdracocephalum_rupe_012 linked recordsC_AA079493.12 linked recordsMT277325.11 linked recordMT277308.11 linked recordOY282509.11 linked recordMT075725.11 linked recordMT277171.11 linked recordMT277223.11 linked recordKF709392.11 linked recordPP554241.11 linked recordOX344733.11 linked recordPX121882.11 linked recordPX091360.11 linked recordMT277226.11 linked recordPP755340.11 linked recordOY776136.11 linked recordOZ258497.11 linked recordglechoma_longituba_011 linked recordOZ060788.11 linked recordOR296704.11 linked recordOZ218192.11 linked recordOZ278035.11 linked recordON631245.11 linked recordMosla_chin_91 linked recordMosla_sooc_21 linked recordPZ530181.11 linked recordC_AA059311.11 linked recordPQ048223.11 linked recordMT277315.11 linked recordOP537517.11 linked recordMK728874.11 linked recordOR113011.11 linked recordMT277169.11 linked recordMT075727.11 linked recordCM056166.11 linked recordNC_023209.11 linked recordOQ001564.11 linked recordPP992923.11 linked recordOQ675154.11 linked recordMT277264.11 linked recordMZ127834.11 linked recordOR344312.11 linked recordMZ127835.11 linked recordOX335799.11 linked recordPX505256.11 linked recordOX940739.11 linked recordPX505255.11 linked recordMW553042.11 linked recordOZ244445.11 linked recordOZ318413.11 linked recordOZ243853.11 linked recordPQ493832.11 linked recordOK563725.11 linked recordKF1773451 linked recordC_AA0593111 linked recordPP9929231 linked recordKF7093921 linked recordPP5542411 linked recordPX1218821 linked recordPX0913601 linked recordPP7553401 linked recordOR2967041 linked recordPQ0482231 linked recordOP5375171 linked recordMK7288741 linked recordOR1130111 linked recordMT0757271 linked recordMZ1278341 linked recordOR3443121 linked recordMZ1278351 linked recordPX5052561 linked recordPX5052551 linked recordMW5530421 linked recordPQ4938321 linked record